Browse
Submit Data
Databases
API
Help

Dataset Information

22 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Comparative Transcriptome Analysis Demonstrates the Positive Effect of the Cyclic AMP Receptor Protein Crp on Daptomycin Biosynthesis in Streptomyces roseosporus.

ABSTRACT: Daptomycin, which is produced by Streptomyces roseosporus, has been characterized as a novel cyclic lipopeptide antibiotic that is effective against Gram-positive bacteria. The biosynthesis of daptomycin is regulated by various factors. In the present study, we demonstrated that the cyclic AMP receptor protein (Crp) plays an important role in producing daptomycin in the S. roseosporus industrial strain. We found that daptomycin production from the crp deletion strain decreased drastically, whereas production from the crp overexpression strain increased by 22.1%. Transcriptome and qPCR analyses showed that some genes related to the daptomycin biosynthetic gene cluster (dpt) and the pleiotropic regulator (adpA) were significantly upregulated. RNA-seq also shows Crp to be a multifunctional regulator that modulates primary metabolism and enhances precursor flux to secondary metabolite biosynthesis. These results provide guidance for the development and improvement of potential natural products.

SUBMITTER: Wu J

PROVIDER: S-EPMC8212052 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

m4C DNA methylation regulates biosynthesis of daptomycin in Streptomyces roseosporus L30.

Project description:Despite numerous studies on transcriptional level regulation by single genes in drug producing Actinomyces, the global regulation based on epigenetic modification is not well explored. N4-methylcytosine (m4C), an abundant epigenetic marker in Actinomycetes' genome, but its regulatory mechanism remains unclear. In this study, we identify a m4C methyltransferase (SroLm3) in Streptomyces roseosporus L30 and multi-omics studies were performed and revealed SroLm3 as a global regulator of secondary metabolism. Notably, three BGCs in ΔsroLm3 strain exhibited decreased expression compared to wild type. In-frame deletion of sroLm3 in S.roseosporus L30 further revealed its role in enhancing daptomycin production. In summary, we characterized a m4C methyltransferase, revealed the function of m4C in secondary metabolism regulation and biosynthesis of red pigment, and mapped a series of novel regulators for daptomycin biosynthesis dominated by m4C methylation. Our research further indicated that m4C DNA methylation may contribute to a metabolic switch from primary to secondary metabolism in Actinomyces.

| S-EPMC9240718 | biostudies-literature

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

Project description:Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

| S-EPMC4421045 | biostudies-literature

Molecular cloning and physical mapping of the daptomycin gene cluster from Streptomyces roseosporus.

Project description:The daptomycin biosynthetic gene cluster of Streptomyces roseosporus was analyzed by Tn5099 mutagenesis, molecular cloning, partial DNA sequencing, and insertional mutagenesis with cloned segments of DNA. The daptomycin biosynthetic gene cluster spans at least 50 kb and is located about 400 to 500 kb from one end of the approximately 7,100-kb linear chromosome. We identified two peptide synthetase coding regions interrupted by a 10- to 20-kb region that may encode other functions in lipopeptide biosynthesis.

| S-EPMC106860 | biostudies-literature

Transcriptional regulation of the daptomycin gene cluster in Streptomyces roseosporus by an autoregulator, AtrA.

Project description:Daptomycin is a cyclic lipopeptide antibiotic produced by Streptomyces roseosporus. To reveal the transcriptional regulatory mechanism of daptomycin biosynthesis, we used the biotinylated dptE promoter (dptEp) as a probe to affinity isolate the dptEp-interactive protein AtrA, a TetR family transcriptional regulator, from the proteome of mycelia. AtrA bound directly to dptEp to positively regulate gene cluster expression and daptomycin production. Meanwhile, both ΔatrA and ΔadpA mutants showed bald phenotype and null production of daptomycin. AdpA positively regulated atrA expression by direct interaction with atrA promoter (atrAp), and removal of ArpA in S. roseosporus, a homolog of the A-factor receptor, resulted in accelerated morphological development and increased daptomycin production, suggesting that atrA was the target of AdpA to mediate the A-factor signaling pathway. Furthermore, AtrA was positively autoregulated by binding to its own promoter atrAp. Thus, for the first time at the transcriptional level, we have identified an autoregulator, AtrA, that directly mediates the A-factor signaling pathway to regulate the proper production of daptomycin.

| S-EPMC4367297 | biostudies-literature

Improving the Yield and Quality of Daptomycin in Streptomyces roseosporus by Multilevel Metabolic Engineering.

Project description:Daptomycin is a cyclic lipopeptide antibiotic with a significant antibacterial action against antibiotic-resistant Gram-positive bacteria. Despite numerous attempts to enhance daptomycin yield throughout the years, the production remains unsatisfactory. This study reports the application of multilevel metabolic engineering strategies in Streptomyces roseosporus to reconstruct high-quality daptomycin overproducing strain L2797-VHb, including precursor engineering (i.e., refactoring kynurenine pathway), regulatory pathway reconstruction (i.e., knocking out negative regulatory genes arpA and phaR), byproduct engineering (i.e., removing pigment), multicopy biosynthetic gene cluster (BGC), and fermentation process engineering (i.e., enhancing O2 supply). The daptomycin titer of L2797-VHb arrived at 113 mg/l with 565% higher comparing the starting strain L2790 (17 mg/l) in shake flasks and was further increased to 786 mg/l in 15 L fermenter. This multilevel metabolic engineering method not only effectively increases daptomycin production, but can also be applied to enhance antibiotic production in other industrial strains.

| S-EPMC9058172 | biostudies-literature

DepR1, a TetR Family Transcriptional Regulator, Positively Regulates Daptomycin Production in an Industrial Producer, Streptomyces roseosporus SW0702.

Project description:Daptomycin is a potent cyclic lipopeptide antibiotic. It is widely used against various Gram-positive bacterial pathogens. Historically, a poor understanding of the transcriptional regulation of daptomycin biosynthesis has limited the options for targeted genetic engineering toward titer improvement. Here, we isolated a TetR family transcriptional regulator, DepR1, from the industrial producer Streptomyces roseosporus SW0702 using a biotinylated dptE promoter (dptEp) as a probe. The direct interaction between DepR1 and dptEp then was confirmed by electrophoretic mobility shift assays and DNase I footprinting assays. The deletion of depR1 led to a reduction in dptEp activity and the cessation of daptomycin production. The ΔdepR1 mutant produced less red pigment and failed to sporulate on R5 medium. This suggests that DepR1 plays a positive role in the control of morphological differentiation. Moreover, DepR1 was positively autoregulated by directly binding to its own promoter. This might account for the positive feedback regulation of daptomycin production. Based on these positive effects, genetic engineering by overexpression of depR1 raised daptomycin production and shortened the fermentation period both in flask and in fermentor.

| S-EPMC4784024 | biostudies-literature

Transcriptional Regulator DasR Represses Daptomycin Production through Both Direct and Cascade Mechanisms in Streptomyces roseosporus.

Project description:Daptomycin, produced by Streptomyces roseosporus, is a clinically important cyclic lipopeptide antibiotic used for the treatment of human infections caused by drug-resistant Gram-positive pathogens. In contrast to most Streptomyces antibiotic biosynthetic gene clusters (BGCs), daptomycin BGC has no cluster-situated regulator (CSR) genes. DasR, a GntR-family transcriptional regulator (TR) widely present in the genus, was shown to regulate antibiotic production in model species S. coelicolor by binding to promoter regions of CSR genes. New findings reported here reveal that DasR pleiotropically regulates production of daptomycin and reddish pigment, and morphological development in S. roseosporus. dasR deletion enhanced daptomycin production and morphological development, but reduced pigment production. DasR inhibited daptomycin production by directly repressing dpt structural genes and global regulatory gene adpA (whose product AdpA protein activates daptomycin production and morphological development). DasR-protected regions on dptEp and adpAp contained a 16 nt sequence similar to the consensus DasR-binding site dre in S. coelicolor. AdpA was shown to target dpt structural genes and dptR2 (which encodes a DeoR-family TR required for daptomycin production). A 10 nt sequence similar to the consensus AdpA-binding site was found on target promoter regions dptAp and dptR2p. This is the first demonstration that DasR regulates antibiotic production both directly and through a cascade mechanism. The findings expand our limited knowledge of the regulatory network underlying daptomycin production, and will facilitate methods for construction of daptomycin overproducers.

| S-EPMC9404778 | biostudies-literature

The cyclic-AMP receptor protein (CRP) regulon in Aggregatibacter actinomycetemcomitans includes leukotoxin.

Project description:The cyclic-AMP receptor protein (CRP) acts as a global regulatory protein among bacteria. Here, the CRP regulon has been defined in Aggregatibacter actinomycetemcomitans using microarray analysis of A. actinomycetemcomitans strain JP2 wild type cells compared to an isogenic crp deletion mutant. Genes whose expression levels changed at least 2-fold with p≤0.05 were considered significant. Of the 300 genes identified as being CRP-regulated, 139 were CRP-activated, including leukotoxin, with the remaining being CRP-repressed. The 300 genes represent 14.2% of ORFs probed which is significantly higher than what has been reported for CRP regulons in other bacteria. If the CRP-regulated genes are put into 17 functional classes, all 17 categories had at least 1 CRP-regulated gene. Several functional categories, mainly transport and binding proteins and energy metabolism proteins, were disproportionately represented in the CRP-regulated subset of genes relative to their overall representation in the genome. This is similar to the patterns seen in other bacteria. Finally, quantitative RT-PCR was used to show that the leukotoxin RNA levels were repressed 16-fold in the CRP mutant indicating that CRP activates leukotoxin transcription. However, this regulation appears to be acting through another regulatory protein since the leukotoxin promoter, unlike ∼129 other promoters of CRP-regulated genes, does not have a match to the consensus CRP-binding site. Several candidate genes for this intermediary transcription factor have been identified in the CRP regulon.

| S-EPMC3120918 | biostudies-literature

Regulatory Patterns of Crp on Monensin Biosynthesis in Streptomyces cinnamonensis.

Project description:Monensin, produced by Streptomyces cinnamonensis, is a polyether ionophore antibiotic widely used as a coccidiostat and a growth-promoting agent in agricultural industry. In this study, cyclic AMP receptor protein (Crp), the global transcription factor for regulation of monensin biosynthesis, was deciphered. The overexpression and antisense RNA silencing of crp revealed that Crp plays a positive role in monensin biosynthesis. RNA sequencing analysis indicated that Crp exhibited extensive regulatory effects on genes involved in both primary metabolic pathways and the monensin biosynthetic gene cluster (mon). The primary metabolic genes, including acs, pckA, accB, acdH, atoB, mutB, epi and ccr, which are pivotal in the biosynthesis of monensin precursors malonyl-CoA, methylmalonyl-CoA and ethylmalonyl-CoA, are transcriptionally upregulated by Crp. Furthermore, Crp upregulates the expression of most mon genes, including all PKS genes (monAI to monAVIII), tailoring genes (monBI-monBII-monCI, monD and monAX) and a pathway-specific regulatory gene (monRI). Enhanced precursor supply and the upregulated expression of mon cluser by Crp would allow the higher production of monensin in S. cinnamonensis. This study gives a more comprehensive understanding of the global regulator Crp and extends the knowledge of Crp regulatory mechanism in Streptomyces.

| S-EPMC7074812 | biostudies-literature

Transcriptional regulator DhyR positively modulates biosynthesis of daptomycin in Streptomyces rosesporus

Project description:The production of daptomycin (DAP) is precisely regulated by a complex regulatory network in Streptomyces roseosporus (S. roseosporus). Although the most biosynthetic pathway of DAP has been elucidated, the regulatory mechanism of its biosynthesis at transcriptional level is not fully understood. In the present study, a transcriptional regulator DhyR has been identified based on our previous quantification proteomics identification in S. roseosporus, and further the dhyR gene deletion mutant has been carried out to reveal DhyR function through transcriptome sequencing and loss-of function validation, which demonstrates DhyR positively regulates DAP biosynthesis in S. rosesporus. In-frame gene deletion of dhyR results in the significant downregulation of the transcription levels of all structural genes in DAP biosynthetic gene cluster and significantly decreases production of DAP. In contrast, overexpression of dhyR enhances transcription levels of DAP biosynthetic gene cluster and leads to a 23% increase of DAP yield. Moreover, the deletion of dhyR resultes in the significant down-regulation of transcription levels of another three regulatory genes, including atrA, depR1 and ssig-05090, which have been demonstrated to be closely associated with the DAP biosynthesis. Transcriptome analyses also support that DhyR modulates carbohydrate metabolism, amino acid metabolism and synthesis and transport pathways of siderophore in S. roseosporus. In summary, our findings indicate that DhyR functions as a pleiotropic regulator of primary and secondary metabolism to involve in DAP biosynthetic regulation of S. roseosporus.

2024-01-01 | GSE251775 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data