Dataset Information

Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan.

ABSTRACT: BACKGROUND:Newcastle Disease (ND) is a highly contagious and economically devastating disease of poultry. At present, limited molecular epidemiological data are available regarding the causes of ND outbreaks in vaccinated commercial poultry farms. Knowing the genomic characteristics of Newcastle disease virus (NDV) infecting commercial poultry operations in spite of vaccination might give important insights on the infection dynamics of these viruses. In addition, molecular analyses at the subgenotype level and studies on the relationship of Japanese NDVs with other isolates from around the world are lacking. Therefore, in the present study, a molecular epidemiological investigation was conducted to characterize nine NDVs isolated from vaccinated commercial poultry flocks in five different Prefectures in non-epidemic areas of Japan between 1969 and 2002. METHODS:Nucleotide sequencing and phylogenetic studies were performed to characterize the complete fusion (F)-protein gene, 3-prime end of the nucleoprotein (NP)-gene and 5-prime end of the RNA dependent RNA polymerase (L)-gene. Sequence data were compared with 180 NDV strains from GenBank representing different NDV genotypes and subgenotypes from different regions of the world at different time periods. Deduced amino acids were analyzed for homologies, recombination and mutation. Recombination events were estimated using Recombination Detection Program (RDP) version 3.44. Phylogenetic trees were constructed to determine evolutionary relationships among strains. RESULTS:Mean death time (MDT: 48-56 hr), Intracerebral Pathogenicity Index (ICPI: 1.7-1.9) and deduced amino acid sequences of the F0 proteolytic cleavage site (112RRQKR116) revealed that all nine field isolates were velogenic. Phylogenetic analysis showed that these isolates could be classified into two genetic lineages and three sublineages namely genotypes VIa (lineage 4a), VId (lineage 4d) and VIId (lineage 5d). No recombination events were observed but a point mutation in one of the neutralizing epitope of the F-protein was identified in the field isolates from Japan. CONCLUSIONS:All field isolates from vaccinated commercial poultry in non-epidemic areas of Japan were part of much bigger outbreaks in provinces and regions and, in some cases, continents. In general, four ND panzootics occurred in Japan and that these outbreaks were mostly characterized by co-circulation of genetically distinct virus lineages due to involvements of infected wild birds. The point mutation identified in the field isolates from Japan may be due to escape from vaccine pressure. The identification of such mutation may be useful for future site-directed mutagenesis to understand the dynamics of NDV infection in vaccinated chickens.

SUBMITTER: Umali DV

PROVIDER: S-EPMC3831826 | biostudies-literature | 2013 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan.

Umali Dennis Villaseñor DV Ito Hiroshi H Suzuki Terumasa T Shirota Kazutoshi K Katoh Hiromitsu H Ito Toshihiro T

Virology journal 20131109

<h4>Background</h4>Newcastle Disease (ND) is a highly contagious and economically devastating disease of poultry. At present, limited molecular epidemiological data are available regarding the causes of ND outbreaks in vaccinated commercial poultry farms. Knowing the genomic characteristics of Newcastle disease virus (NDV) infecting commercial poultry operations in spite of vaccination might give important insights on the infection dynamics of these viruses. In addition, molecular analyses at th ...[more]

PMID: 24209870

Similar Datasets

Project description:Background and aimThe Marek's disease virus (MDV) is a neoplastic disease causing serious economic losses in poultry production. This study aimed to investigate MDV occurrence in poultry flocks in the Lower Egypt during the 2020 breakout and genetically characterized Meq, gL, and ICP4 genes in field strains of MDV.Materials and methodsForty samples were collected from different breeds from eight Egyptian governorates in 2020. All flocks had received a bivalent vaccine (herpesvirus of turkey FC-126 + Rispens CVI988). However, weight loss, emaciation, reduced egg production, paralysis, and rough/raised feather follicles occurred. Samples were collected from feather follicles, liver, spleen, and nerve tissue for diagnosis by polymerase chain reaction. MDV genetic characterization was then performed by sequencing the Meq, gL, and ICP4 genes of five positive samples representing different governorates and breeds.ResultsA total of 28 samples were positive for MDV field strains, while two were related to MDV vaccinal strains. All samples tested negative for ALV (A, B, C, D, and J) and REV. Phylogenetic analysis of the Meq gene of sequenced samples revealed that all MDVs were related to the highly virulent European viruses (Gallid herpesvirus 2 ATE and PC12/30) with high amino acid (A.A.) identity 99.2-100%. Alternatively, there was low A.A. identity with the vaccine strains CVI988 and 3004 (up to 82.5%). These results indicate that further investigation of the efficacy of current Egyptian vaccines is required. The Egyptian strains also harbor a specific mutation, allowing clustering into two subgroups (A and B). By mutation analysis of the Meq gene, the Egyptian viruses in our study had R101K, P217A, and E263D mutations present in all Egyptian viruses. Furthermore, R176A and T180A mutations specific to our strains contributed to the high virulence of highly virulent strains. There were no mutations of the gL or ICP4 genes.ConclusionFurther studies should evaluate the protection contributed by current vaccines used in Egypt.

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan.

Publications

Molecular epidemiology of Newcastle disease virus isolates from vaccinated commercial poultry farms in non-epidemic areas of Japan.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets