Presence of virulent Newcastle disease virus in vaccinated chickens in farms in Pakistan.
Ontology highlight
ABSTRACT:
SUBMITTER: Rehmani SF
PROVIDER: S-EPMC4400789 | biostudies-literature | 2015 May
REPOSITORIES: biostudies-literature
Publications
Presence of virulent Newcastle disease virus in vaccinated chickens in farms in Pakistan.
Rehmani Shafqat Fatima SF Wajid Abdul A Bibi Tasra T Nazir Bushra B Mukhtar Nadia N Hussain Abid A Lone Nazir Ahmad NA Yaqub Tahir T Afonso Claudio L CL
Journal of clinical microbiology 20150218 5
One year after a virulent Newcastle disease virus (vNDV) outbreak in Pakistan, the causative strain was present in vaccinated chickens of multiple farms despite the existence of high-average NDV-specific antibody titers (>4.75 log2). The data suggest a possible role of vaccinated birds as reservoirs of vNDV. ...[more]
Similar Datasets
Project description:Newcastle disease virus (NDV) strain F is a lentogenic vaccine strain used for primary vaccination in day-old chickens against Newcastle disease (ND) in India and Southeast Asian countries. Recombinant NDV-F virus and another recombinant NDV harboring the major capsid protein VP2 gene of a very virulent infectious bursal disease virus (IBDV); namely rNDV-F and rNDV-F/VP2, respectively, were generated using the NDV F strain. The rNDV-F/VP2 virus was slightly attenuated, as compared to the rNDV-F virus, as evidenced from the mean death time and intracerebral pathogenicity index analysis. This result indicates that rNDV-F/VP2 behaves as a lentogenic virus and it is stable even after 10 serial passages in embryonated chicken eggs. When chickens were vaccinated with the rNDV F/VP2, it induced both humoral and cell mediated immunity, and was able to confer complete protection against very virulent IBDV challenge and 80% protection against virulent NDV challenge. These results suggest that rNDV-F could be an effective and inherently safe vaccine vector. Here, we demonstrate that a bivalent NDV-IBDV vaccine candidate generated by reverse genetics method is safe, efficacious and cost-effective, which will greatly aid the poultry industry in developing countries.
| S-EPMC5748598 | biostudies-literature
Project description:The genome sequence of a new strain of Newcastle disease virus (NDV) (chicken/Pak/Quality Operations Lab/SFR-611/13) is reported here. The strain was isolated from a vaccinated chicken flock in Pakistan in 2013 and has panzootic features. The genome is 15,192 nucleotides in length and is classified in subgenotype VIIi of genotype VII, class II.
| S-EPMC4472901 | biostudies-literature
Project description:Airway epithelial cells from 3 different breeds of chicken infected with Newcastle Disease virus were sequenced and compared to cells from uninfected control birds. The 3 breeds were an indigenous breed, commercial Rhode Island Reds and a hybrid breed (Kenbro).
2015-01-19 | E-MTAB-3068 | biostudies-arrayexpress
Project description:Newcastle disease virus (NDV) and H9N2 subtype Avian influenza virus (AIV) are two notorious avian respiratory pathogens that cause great losses in the poultry industry. Current inactivated commercial vaccines against NDV and AIV have the disadvantages of inadequate mucosal responses, while an attenuated live vaccine bears the risk of mutation. Dendritic cell (DC) targeting strategies are attractive for their potent mucosal and adaptive immune-stimulating ability against respiratory pathogens. In this study, DC-binding peptide (DCpep)-decorated chimeric virus-like particles (cVLPs), containing NDV haemagglutinin-neuraminidase (HN) and AIV haemagglutinin (HA), were developed as a DC-targeting mucosal vaccine candidate. DCpep-decorated cVLPs activated DCs in vitro, and induced potent immune stimulation in chickens, with enhanced secretory immunoglobulin A (sIgA) secretion and splenic T cell differentiation. 40 μg cVLPs can provide full protection against the challenge with homologous, heterologous NDV strains, and AIV H9N2. In addition, DCpep-decorated cVLPs could induce a better immune response when administered intranasally than intramuscularly, as indicated by robust sIgA secretion and a reduced virus shedding period. Taken together, this chimeric VLPs are a promising vaccine candidate to control NDV and AIV H9N2 and a useful platform bearing multivalent antigens.
| S-EPMC7462956 | biostudies-literature
Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.
| S-EPMC5993761 | biostudies-literature
Project description:Kenyan poultry consists of ~80% free-range indigenous chickens kept in small flocks (~30 birds) on backyard poultry farms (BPFs) and they are traded via live bird markets (LBMs). Newcastle disease virus (NDV) was detected in samples collected from chickens, wild farm birds, and other domestic poultry species during a 2017-2018 survey conducted at 66 BPFs and 21 LBMs in nine Kenyan counties. NDV nucleic acids were detected by rRT-PCR L-test in 39.5% (641/1621) of 1621 analyzed samples, of which 9.67% (62/641) were NDV-positive by both the L-test and a fusion-test designed to identify the virulent virus, with a majority being at LBMs (64.5%; 40/62) compared to BPFs (25.5%; 22/62). Virus isolation and next-generation sequencing (NGS) on a subset of samples resulted in 32 complete NDV genome sequences with 95.8-100% nucleotide identities amongst themselves and 95.7-98.2% identity with other east African isolates from 2010-2016. These isolates were classified as a new sub-genotype, V.3, and shared 86.5-88.9% and 88.5-91.8% nucleotide identities with subgenotypes V.1 and V.2 viruses, respectively. The putative fusion protein cleavage site (113R-Q-K-R↓F 117) in all 32 isolates, and a 1.86 ICPI score of an isolate from a BPF chicken that had clinical signs consistent with Newcastle disease, confirmed the high virulence of the NDVs. Compared to genotypes V and VI viruses, the attachment (HN) protein of 18 of the 32 vNDVs had amino acid substitutions in the antigenic sites. A time-scaled phylogeographic analysis suggests a west-to-east dispersal of the NDVs via the live chicken trade, but the virus origins remain unconfirmed due to scarcity of continuous and systematic surveillance data. This study reveals the widespread prevalence of vNDVs in Kenyan backyard poultry, the central role of LBMs in the dispersal and possibly generation of new virus variants, and the need for robust molecular epidemiological surveillance in poultry and non-poultry avian species.
| S-EPMC7828601 | biostudies-literature
Project description:BackgroundDue to the more stability and a better homogenecity in immune response, the use of thermoresistant vaccines in different chicken types has been increased.ObjectiveThis study aimed to evaluate the efficacy of a newly developed Newcastle disease vaccine (ND.TR.IR) originating from I-2 strain in specific pathogen-free (SPF) and native and broiler chickens.MethodsFollowing determination of pathogenicity indices on the candidate seed, three efficacy examinations were conducted. In the first experiment, 120 1-day-old SPF chickens were randomly allocated to six groups and either vaccinated with ND.TR.IR via eye drop at 1, 7, and 21 days of age (V1 , V7 , and V21 ), or considered as non-vaccinated control groups (C1 , C7 , and C21 ). At 20th post-vaccination day, sera hemagglutination inhibition (HI) antibody titres against ND virus (NDV) were measured and then the chickens were challenged by virulent NDV (vNDV). In the second and third experiments, the efficacy of ND.TR.IR vaccine was compared to routine vaccination program (B1 and LaSota) in native and broiler chickens that were vaccinated at 10 and 20 days of age, respectively. The HI antibody titres were measured on 10, 20, 30, and 40 days of age, and also challenge efficacy test with vNDV was conducted on 30 days of age.ResultsThe studied virus, as a vaccinal seed, complied with the pathogenicity indices of avirulent NDV and molecular identity of I-2 strain. In the efficacy evaluation trials, the vaccinated chickens had higher HI antibody titres against NDV compared with their corresponding control chickens (p < 0.05). Results of the challenge tests indicated 95% and 100% protection against vNDV in native, SPF, and broiler-vaccinated chickens, respectively.ConclusionsThe present findings indicated that administration of ND.TR.IR induced appropriate HI antibody titres against NDV in SPF, native, and broiler chickens associated with good protection in efficacy test.
| S-EPMC9297754 | biostudies-literature
Project description:BACKGROUND:Newcastle Disease (ND) is a highly contagious and economically devastating disease of poultry. At present, limited molecular epidemiological data are available regarding the causes of ND outbreaks in vaccinated commercial poultry farms. Knowing the genomic characteristics of Newcastle disease virus (NDV) infecting commercial poultry operations in spite of vaccination might give important insights on the infection dynamics of these viruses. In addition, molecular analyses at the subgenotype level and studies on the relationship of Japanese NDVs with other isolates from around the world are lacking. Therefore, in the present study, a molecular epidemiological investigation was conducted to characterize nine NDVs isolated from vaccinated commercial poultry flocks in five different Prefectures in non-epidemic areas of Japan between 1969 and 2002. METHODS:Nucleotide sequencing and phylogenetic studies were performed to characterize the complete fusion (F)-protein gene, 3-prime end of the nucleoprotein (NP)-gene and 5-prime end of the RNA dependent RNA polymerase (L)-gene. Sequence data were compared with 180 NDV strains from GenBank representing different NDV genotypes and subgenotypes from different regions of the world at different time periods. Deduced amino acids were analyzed for homologies, recombination and mutation. Recombination events were estimated using Recombination Detection Program (RDP) version 3.44. Phylogenetic trees were constructed to determine evolutionary relationships among strains. RESULTS:Mean death time (MDT: 48-56 hr), Intracerebral Pathogenicity Index (ICPI: 1.7-1.9) and deduced amino acid sequences of the F0 proteolytic cleavage site (112RRQKR116) revealed that all nine field isolates were velogenic. Phylogenetic analysis showed that these isolates could be classified into two genetic lineages and three sublineages namely genotypes VIa (lineage 4a), VId (lineage 4d) and VIId (lineage 5d). No recombination events were observed but a point mutation in one of the neutralizing epitope of the F-protein was identified in the field isolates from Japan. CONCLUSIONS:All field isolates from vaccinated commercial poultry in non-epidemic areas of Japan were part of much bigger outbreaks in provinces and regions and, in some cases, continents. In general, four ND panzootics occurred in Japan and that these outbreaks were mostly characterized by co-circulation of genetically distinct virus lineages due to involvements of infected wild birds. The point mutation identified in the field isolates from Japan may be due to escape from vaccine pressure. The identification of such mutation may be useful for future site-directed mutagenesis to understand the dynamics of NDV infection in vaccinated chickens.
| S-EPMC3831826 | biostudies-literature
Project description:Newcastle Disease virus infection in chickens
| PRJEB7672 | ENA
Project description:Maternally derived antibodies (MDA) substantially interfere with active immunity in post-hatch vaccination, although they provide early protection against disease through passive immunity in young chickens. Previously, Newcastle disease virus (NDV) strain TS09-C was demonstrated to be safe and immunogenic as in-ovo vaccine in specific-pathogen-free chickens. Here, we evaluated the safety, protective efficacy, and duration of clinical protection of the TS09-C virus as an in-ovo vaccine for commercial chickens in the presence of Maternally derived antibodies against NDV. This vaccine was safe in commercial chickens and provided at least 80% protection against a virulent NDV challenge for 3 mo, despite inducing a low hemagglutinin-inhibition titer. For commercial chickens, the protective efficacy of the in-ovo vaccination was markedly higher than that of posthatch vaccination, and the cellular immune response might play an important role in the higher protective efficacy of the in-ovo vaccine. The overall results indicate that the maternally derived antibodies against NDV do not significantly interfere with the ability of the in-ovo vaccine strain TS09-C to induce protective cellular immunity.
| S-EPMC7597455 | biostudies-literature