Dataset Information

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms.

ABSTRACT:

Background and aim

Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.

Materials and methods

The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.

Result

The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.

Conclusion

Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

SUBMITTER: Triosanti LS

PROVIDER: S-EPMC5993761 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:BackgroundNewcastle disease virus (NDV) belongs to the genus Avaluvirus and Paramyxoviridae family, and it can cause acute, highly contagious Newcastle disease in poultry. The two proteins, haemagglutinin neuraminidase (HN) and Fusion (F), are the main virulence factor of the virus and play an essential role in immunogenicity against the virus. In most paramyxoviruses, the F protein requires HN protein to fuse the membrane, and HN proteins substantially enhance the viruses' fusion activity.ResultsThe present study describes the successful cloning and expression of HN protein from NDV in Bacillus subtilis WB800 using the modified shuttle vector pHT43. HN coding sequence was cloned into the pGet II vector. It was then subcloned into the PHT43 shuttle vector and transferred to Escherichia coli for replication. The recombinant plasmid was extracted from E. coli and used to transform B. subtilis by electroporation. After induction of recombinant B. subtilis by IPTG, total cell protein and the protein secreted into the media were analysed through a time course using SDS-PAGE. The expressed HN protein was purified using cation exchange chromatography followed by metal affinity chromatography, using the 6× His epitope introduced at the carboxyl terminus of the recombinant protein. The accuracy of the PHT43-HN construct was confirmed by sequencing and enzymatic digestion. SDS-PAGE results showed that the recombinant HN protein was successfully expressed and secreted into the medium. Moreover, the purified HN protein showed neuraminidase activity with characteristics similar to the indigenous HN NDV protein. B. subtilis is a free endotoxin host that could be a favourite prokaryotic platform for producing the recombinant HN protein.ConclusionThe establishment of this expression and purification system has allowed us to explore further the biochemical characteristics of HN protein and obtain material that could be suitable for a new production of NDV candidate vaccine with high immunogenicity.