Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A computational framework for boosting confidence in high-throughput protein-protein interaction datasets.

ABSTRACT: Improving the quality and coverage of the protein interactome is of tantamount importance for biomedical research, particularly given the various sources of uncertainty in high-throughput techniques. We introduce a structure-based framework, Coev2Net, for computing a single confidence score that addresses both false-positive and false-negative rates. Coev2Net is easily applied to thousands of binary protein interactions and has superior predictive performance over existing methods. We experimentally validate selected high-confidence predictions in the human MAPK network and show that predicted interfaces are enriched for cancer -related or damaging SNPs. Coev2Net can be downloaded at http://struct2net.csail.mit.edu.

SUBMITTER: Hosur R

PROVIDER: S-EPMC4053744 | biostudies-literature | 2012 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

A computational framework for boosting confidence in high-throughput protein-protein interaction datasets.

Hosur Raghavendra R Peng Jian J Vinayagam Arunachalam A Stelzl Ulrich U Xu Jinbo J Perrimon Norbert N Bienkowska Jadwiga J Berger Bonnie B

Genome biology 20120831 8

Improving the quality and coverage of the protein interactome is of tantamount importance for biomedical research, particularly given the various sources of uncertainty in high-throughput techniques. We introduce a structure-based framework, Coev2Net, for computing a single confidence score that addresses both false-positive and false-negative rates. Coev2Net is easily applied to thousands of binary protein interactions and has superior predictive performance over existing methods. We experiment ...[more]

PMID: 22937800

Similar Datasets

A Computational Framework for High-Throughput Isotopic Natural Abundance Correction of Omics-Level Ultra-High Resolution FT-MS Datasets.

Project description:New metabolomics applications of ultra-high resolution and accuracy mass spectrometry can provide thousands of detectable isotopologues, with the number of potentially detectable isotopologues increasing exponentially with the number of stable isotopes used in newer isotope tracing methods like stable isotope-resolved metabolomics (SIRM) experiments. This huge increase in usable data requires software capable of correcting the large number of isotopologue peaks resulting from SIRM experiments in a timely manner. We describe the design of a new algorithm and software system capable of handling these high volumes of data, while including quality control methods for maintaining data quality. We validate this new algorithm against a previous single isotope correction algorithm in a two-step cross-validation. Next, we demonstrate the algorithm and correct for the effects of natural abundance for both (13)C and (15)N isotopes on a set of raw isotopologue intensities of UDP-N-acetyl-D-glucosamine derived from a (13)C/(15)N-tracing experiment. Finally, we demonstrate the algorithm on a full omics-level dataset.

| S-EPMC3882318 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress

Data Mining and Computational Modeling of High-Throughput Screening Datasets.

Project description:We are now seeing the benefit of investments made over the last decade in high-throughput screening (HTS) that is resulting in large structure activity datasets entering public and open databases such as ChEMBL and PubChem. The growth of academic HTS screening centers and the increasing move to academia for early stage drug discovery suggests a great need for the informatics tools and methods to mine such data and learn from it. Collaborative Drug Discovery, Inc. (CDD) has developed a number of tools for storing, mining, securely and selectively sharing, as well as learning from such HTS data. We present a new web based data mining and visualization module directly within the CDD Vault platform for high-throughput drug discovery data that makes use of a novel technology stack following modern reactive design principles. We also describe CDD Models within the CDD Vault platform that enables researchers to share models, share predictions from models, and create models from distributed, heterogeneous data. Our system is built on top of the Collaborative Drug Discovery Vault Activity and Registration data repository ecosystem which allows users to manipulate and visualize thousands of molecules in real time. This can be performed in any browser on any platform. In this chapter we present examples of its use with public datasets in CDD Vault. Such approaches can complement other cheminformatics tools, whether open source or commercial, in providing approaches for data mining and modeling of HTS data.

| S-EPMC6181121 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the SubSeries listed below.

2009-06-03 | GSE14696 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

2009-06-03 | GSE14694 | GEO

Computational and analytical framework for small RNA profiling by high-throughput sequencing.

Project description:The advent of high-throughput sequencing (HTS) methods has enabled direct approaches to quantitatively profile small RNA populations. However, these methods have been limited by several factors, including representational artifacts and lack of established statistical methods of analysis. Furthermore, massive HTS data sets present new problems related to data processing and mapping to a reference genome. Here, we show that cluster-based sequencing-by-synthesis technology is highly reproducible as a quantitative profiling tool for several classes of small RNA from Arabidopsis thaliana. We introduce the use of synthetic RNA oligoribonucleotide standards to facilitate objective normalization between HTS data sets, and adapt microarray-type methods for statistical analysis of multiple samples. These methods were tested successfully using mutants with small RNA biogenesis (miRNA-defective dcl1 mutant and siRNA-defective dcl2 dcl3 dcl4 triple mutant) or effector protein (ago1 mutant) deficiencies. Computational methods were also developed to rapidly and accurately parse, quantify, and map small RNA data.

| S-EPMC2673065 | biostudies-literature

Protein complex-based analysis framework for high-throughput data sets.

Project description:Analysis of high-throughput data increasingly relies on pathway annotation and functional information derived from Gene Ontology. This approach has limitations, in particular for the analysis of network dynamics over time or under different experimental conditions, in which modules within a network rather than complete pathways might respond and change. We report an analysis framework based on protein complexes, which are at the core of network reorganization. We generated a protein complex resource for human, Drosophila, and yeast from the literature and databases of protein-protein interaction networks, with each species having thousands of complexes. We developed COMPLEAT (http://www.flyrnai.org/compleat), a tool for data mining and visualization for complex-based analysis of high-throughput data sets, as well as analysis and integration of heterogeneous proteomics and gene expression data sets. With COMPLEAT, we identified dynamically regulated protein complexes among genome-wide RNA interference data sets that used the abundance of phosphorylated extracellular signal-regulated kinase in cells stimulated with either insulin or epidermal growth factor as the output. The analysis predicted that the Brahma complex participated in the insulin response.

| S-EPMC3756668 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data