Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

ABSTRACT: This SuperSeries is composed of the SubSeries listed below.

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE14696 | GEO | 2009/06/03

SECONDARY ACCESSION(S): PRJNA112327

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress

Computational and analytical framework for small RNA profiling by high-throughput sequencing.

Project description:The advent of high-throughput sequencing (HTS) methods has enabled direct approaches to quantitatively profile small RNA populations. However, these methods have been limited by several factors, including representational artifacts and lack of established statistical methods of analysis. Furthermore, massive HTS data sets present new problems related to data processing and mapping to a reference genome. Here, we show that cluster-based sequencing-by-synthesis technology is highly reproducible as a quantitative profiling tool for several classes of small RNA from Arabidopsis thaliana. We introduce the use of synthetic RNA oligoribonucleotide standards to facilitate objective normalization between HTS data sets, and adapt microarray-type methods for statistical analysis of multiple samples. These methods were tested successfully using mutants with small RNA biogenesis (miRNA-defective dcl1 mutant and siRNA-defective dcl2 dcl3 dcl4 triple mutant) or effector protein (ago1 mutant) deficiencies. Computational methods were also developed to rapidly and accurately parse, quantify, and map small RNA data.

| S-EPMC2673065 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

2009-06-03 | GSE14694 | GEO

High-throughput sequencing of small RNAs: Caenorhabditis elegans

Project description:This SuperSeries is composed of the SubSeries listed below.

2008-06-16 | GSE11738 | GEO

Expression profiling by high throughput sequencing of NDP52

Project description:This SuperSeries is composed of the SubSeries listed below.

2021-11-17 | GSE188567 | GEO

Small noncoding RNA discovery and profiling with sRNAtools based on high-throughput sequencing.

Project description:Small noncoding RNAs (sRNA/sncRNAs) are generated from different genomic loci and play important roles in biological processes, such as cell proliferation and the regulation of gene expression. Next-generation sequencing (NGS) has provided an unprecedented opportunity to discover and quantify diverse kinds of sncRNA, such as tRFs (tRNA-derived small RNA fragments), phasiRNAs (phased, secondary, small-interfering RNAs), Piwi-interacting RNA (piRNAs) and plant-specific 24-nt short interfering RNAs (siRNAs). However, currently available web-based tools do not provide approaches to comprehensively analyze all of these diverse sncRNAs. This study presents a novel integrated platform, sRNAtools (https://bioinformatics.caf.ac.cn/sRNAtools), that can be used in conjunction with high-throughput sequencing to identify and functionally annotate sncRNAs, including profiling microRNAss, piRNAs, tRNAs, small nuclear RNAs, small nucleolar RNAs and rRNAs and discovering isomiRs, tRFs, phasiRNAs and plant-specific 24-nt siRNAs for up to 21 model organisms. Different modules, including single case, batch case, group case and target case, are developed to provide users with flexible ways of studying sncRNA. In addition, sRNAtools supports different ways of uploading small RNA sequencing data in a very interactive queue system, while local versions based on the program package/Docker/virtureBox are also available. We believe that sRNAtools will greatly benefit the scientific community as an integrated tool for studying sncRNAs.

| S-EPMC7820841 | biostudies-literature

High-throughput sequencing of strawberry fruits

Project description:This SuperSeries is composed of the SubSeries listed below.

2024-09-25 | GSE208640 | GEO