Browse
Submit Data
Databases
API
Help

Dataset Information

27 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

ABSTRACT: Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

SUBMITTER: Dupont A

PROVIDER: S-EPMC4118039 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Glyceraldehyde-3-phosphate Dehydrogenase Common Peptides of Listeria monocytogenes, Mycobacterium marinum and Streptococcus pneumoniae as Universal Vaccines.

Project description:Universal vaccines can be prepared with antigens common to different pathogens. In this regard, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a common virulence factor among pathogenic bacteria of the genera Listeria, Mycobacterium and Streptococcus. Their N-terminal 22 amino acid peptides, GAPDH-L1 (Listeria), GAPDH-M1 (Mycobacterium) and GAPDH-S1 (Streptococcus), share 95-98.55% sequence homology, biochemical and MHC binding abilities and, therefore, are good candidates for universal vaccine designs. Here, we used dendritic cells (DC) as vaccine platforms to test GAPDH epitopes that conferred protection against Listeria monocytogenes, Mycobacterium marinum or Streptococcus pneumoniae in our search of epitopes for universal vaccines. DC loaded with GAPDH-L1, GAPDH-M1 or GAPDH-S1 peptides show high immunogenicity measured by the cellular DTH responses in mice, lacked toxicity and were capable of cross-protection immunity against mice infections with each one of the pathogens. Vaccine efficiency correlated with high titers of anti-GAPDH-L1 antibodies in sera of vaccinated mice, a Th1 cytokine pattern and high frequencies of GAPDH-L1-specific CD4+ and CD8+ T cells and IFN-γ producers in the spleens. We concluded that GAPDH-L1 peptide was the best epitope for universal vaccines in the Listeria, Mycobacterium or Streptococcus taxonomic groups, whose pathogenic strains caused relevant morbidities in adults and especially in the elderly.

| S-EPMC8002646 | biostudies-literature

Role of <i>Streptococcus pneumoniae</i> Proteins in Evasion of Complement-Mediated Immunity.

Project description:The complement system plays a central role in immune defense against Streptococcus pneumoniae. In order to evade complement attack, pneumococci have evolved a number of mechanisms that limit complement mediated opsonization and subsequent phagocytosis. This review focuses on the strategies employed by pneumococci to circumvent complement mediated immunity, both in vitro and in vivo. At last, since many of the proteins involved in interactions with complement components are vaccine candidates in different stages of validation, we explore the use of these antigens alone or in combination, as potential vaccine approaches that aim at elimination or drastic reduction in the ability of this bacterium to evade complement.

| S-EPMC5316553 | biostudies-literature

Intracellular replication of Streptococcus pneumoniae inside splenic macrophages serves as a reservoir for septicaemia.

Project description:Bacterial septicaemia is a major cause of mortality, but its pathogenesis remains poorly understood. In experimental pneumococcal murine intravenous infection, an initial reduction of bacteria in the blood is followed hours later by a fatal septicaemia. These events represent a population bottleneck driven by efficient clearance of pneumococci by splenic macrophages and neutrophils, but as we show in this study, accompanied by occasional intracellular replication of bacteria that are taken up by a subset of CD169+ splenic macrophages. In this model, proliferation of these sequestered bacteria provides a reservoir for dissemination of pneumococci into the bloodstream, as demonstrated by its prevention using an anti-CD169 monoclonal antibody treatment. Intracellular replication of pneumococci within CD169+ splenic macrophages was also observed in an ex vivo porcine spleen, where the microanatomy is comparable with humans. We also showed that macrolides, which effectively penetrate macrophages, prevented septicaemia, whereas beta-lactams, with inefficient intracellular penetration, failed to prevent dissemination to the blood. Our findings define a shift in our understanding of the pneumococcus from an exclusively extracellular pathogen to one with an intracellular phase. These findings open the door to the development of treatments that target this early, previously unrecognized intracellular phase of bacterial sepsis.

| S-EPMC6207342 | biostudies-literature

Low-dose recombinant properdin provides substantial protection against Streptococcus pneumoniae and Neisseria meningitidis infection.

Project description:Modern medicine has established three central antimicrobial therapeutic concepts: vaccination, antibiotics, and, recently, the use of active immunotherapy to enhance the immune response toward specific pathogens. The efficacy of vaccination and antibiotics is limited by the emergence of new pathogen strains and the increased incidence of antibiotic resistance. To date, immunotherapy development has focused mainly on cytokines. Here we report the successful therapeutic application of a complement component, a recombinant form of properdin (Pn), with significantly higher activity than native properdin, which promotes complement activation via the alternative pathway, affording protection against N. menigitidis and S. pneumoniae. In a mouse model of infection, we challenged C57BL/6 WT mice with N. menigitidis B-MC58 6 h after i.p. administration of Pn (100 µg/mouse) or buffer alone. Twelve hours later, all control mice showed clear symptoms of infectious disease while the Pn treated group looked healthy. After 16 hours, all control mice developed sepsis and had to be culled, while only 10% of Pn treated mice presented with sepsis and recoverable levels of live Meningococci. In a parallel experiment, mice were challenged intranasally with a lethal dose of S. pneumoniae D39. Mice that received a single i.p. dose of Pn at the time of infection showed no signs of bacteremia at 12 h postinfection and had prolonged survival times compared with the saline-treated control group (P < 0.0001). Our findings show a significant therapeutic benefit of Pn administration and suggest that its antimicrobial activity could open new avenues for fighting infections caused by multidrug-resistant neisserial or streptococcal strains.

| S-EPMC3986141 | biostudies-literature

Role for telomerase in Listeria monocytogenes infection.

Project description:Human telomerase reverse transcriptase (hTERT) is the catalytic subunit of the human telomerase complex. Growing evidence suggests that hTERT also contributes to the cell physiology independently of telomere elongation. However, its role in bacterial infection is unknown. Here we show that hTERT is critical for Listeria monocytogenes infection, as the depletion of hTERT impaired bacterial intracellular replication. In addition, we observed that L. monocytogenes caused a decrease in hTERT levels at early time points of the infectious process. This effect was mediated by the pore-forming toxin listeriolysin O (LLO) and did not require bacterial entry into host cells. Calcium influx through the LLO pores contributed to a proteasome-independent decrease in hTERT protein levels. Together, our data provide evidence that these bacteria trigger hTERT degradation, an event that is detrimental to bacterial replication.

| S-EPMC3497413 | biostudies-literature

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences.

Project description:Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.

| S-EPMC3927391 | biostudies-literature

The role of properdin in zymosan- and Escherichia coli-induced complement activation.

Project description:Properdin is well known as an enhancer of the alternative complement amplification loop when C3 is activated, whereas its role as a recognition molecule of exogenous pathogen-associated molecular patterns and initiator of complement activation is less understood. We therefore studied the role of properdin in activation of complement in normal human serum by zymosan and various Escherichia coli strains. In ELISA, microtiter plates coated with zymosan induced efficient complement activation with deposition of C4b and terminal complement complex on the solid phase. Virtually no deposition of C4b or terminal complement complex was observed with mannose-binding lectin (MBL)-deficient serum. Reconstitution with purified MBL showed distinct activation in both readouts. In ELISA, normal human serum-induced deposition of properdin by zymosan was abolished by the C3-inhibiting peptide compstatin. Flow cytometry was used to further explore whether properdin acts as an initial recognition molecule reacting directly with zymosan and three E. coli strains. Experiments reported by other authors were made with EGTA Mg²⁺ buffer, permitting autoactivation of C3. We found inhibition by compstatin on these substrates, indicating that properdin deposition depended on initial C3b deposition followed by properdin in a second step. Properdin released from human polymorphonuclear cells stimulated with PMA did not bind to zymosan or E. coli, but when incubated in properdin-depleted serum this form of properdin bound efficiently to both substrates in a strictly C3-dependent manner, as the binding was abolished by compstatin. Collectively, these data indicate that properdin in serum as well as polymorphonuclear-released properdin is unable to bind and initiate direct alternative pathway activation on these substrates.

| S-EPMC3424343 | biostudies-literature

Understanding the bacterial polysaccharide antigenicity of Streptococcus agalactiae versus Streptococcus pneumoniae.

Project description:Bacterial surface capsular polysaccharides (CPS) that are similar in carbohydrate sequence may differ markedly in immunogenicity and antigenicity. The structural origin of these phenomena is poorly understood. Such a case is presented by the Gram-positive bacteria Streptococcus agalactiae (Group B Streptococcus; GBS) type III (GBSIII) and Streptococcus pneumoniae (Pn) type 14 (Pn14), which share closely related CPS sequences. Nevertheless, antibodies (Abs) against GBSIII rarely cross-react with the CPS from Pn14. To establish the origin for the variation in CPS antigenicity, models for the immune complexes of CPS fragments from GBSIII and Pn14, with the variable fragment (Fv) of a GBS-specific mAb (mAb 1B1), are presented. The complexes are generated through a combination of comparative Ab modeling and automated ligand docking, followed by explicitly solvated 10-ns molecular dynamics simulations. The relationship between carbohydrate sequence and antigenicity is further quantified through the computation of interaction energies using the Molecular Mechanics-Generalized Born Surface Area (MM-GBSA) method, augmented by conformational entropy estimates. Despite the electrostatic differences between Pn14 and GBSIII CPS, analysis indicates that entropic penalties are primarily responsible for the loss of affinity of the highly flexible Pn14 CPS for mAb 1B1. The similarity of the solution conformation of the relatively rigid GBSIII CPS with that in the immune complex characterizes the previously undescribed 3D structure of the conformational epitope. The analysis provides a comprehensive interpretation for a large body of biochemical and immunological data related to Ab recognition of bacterial polysaccharides and should be applicable to other Ab-carbohydrate interactions.

| S-EPMC1472444 | biostudies-literature

Listeria monocytogenes meningitis.

Project description:Tumbling motility is one of the useful characteristics of Listeria monocytogenes. This can be helpful to identify the causative pathogen along with Gram staining before the confirmatory microbiological examination.

| S-EPMC5986172 | biostudies-other

A Role for Taok2 in Listeria monocytogenes Vacuolar Escape.

Project description:The bacterial pathogen Listeria monocytogenes invades host cells, ruptures the internalization vacuole, and reaches the cytosol for replication. A high-content small interfering RNA (siRNA) microscopy screen allowed us to identify epithelial cell factors involved in L. monocytogenes vacuolar rupture, including the serine/threonine kinase Taok2. Kinase activity inhibition using a specific drug validated a role for Taok2 in favoring L. monocytogenes cytoplasmic access. Furthermore, we showed that Taok2 recruitment to L. monocytogenes vacuoles requires the presence of pore-forming toxin listeriolysin O. Overall, our study identified the first set of host factors modulating L. monocytogenes vacuolar rupture and cytoplasmic access in epithelial cells.

| S-EPMC8922001 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data