Dataset Information

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

ABSTRACT: Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven ?-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression.

SUBMITTER: Feng Y

PROVIDER: S-EPMC4134263 | biostudies-literature | 2014 Jul-Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

Feng Youjun Y Cronan John E JE

Research in microbiology 20140509 6

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of ...[more]

PMID: 24816490

Similar Datasets

Project description:Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein that both represses biotin operon transcription and ligates biotin to its cognate proteins.

Project description:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in ?-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ?-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ?-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

Dataset Information

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

Publications

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets