Dataset Information

Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

ABSTRACT: Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein that both represses biotin operon transcription and ligates biotin to its cognate proteins.

SUBMITTER: Cronan JE

PROVIDER: S-EPMC4233344 | biostudies-literature | 2014 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

Cronan John E JE

EcoSal Plus 20140501 1

Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both ...[more]

PMID: 26442940

Similar Datasets

Project description:For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and ?-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicumIMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis, which use an individual nonaggregating type II fatty acid synthase (FAS-II) system. In this study, we reported genetic evidence demonstrating that the FAS-I system is the source of the biotin precursor in vivo in the engineered biotin-prototrophic C. glutamicum strain. This study also uncovered the important physiological role of FasB in lipoic acid biosynthesis. Here, we present an FAS-I enzyme that functions in supplying the lipoic acid precursor, although its biosynthesis has been believed to exclusively depend on FAS-II in organisms. The findings obtained here provide new insights into the metabolic engineering of this industrially important microorganism to produce these compounds effectively.

Project description:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in ?-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ?-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ?-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

Project description:To determine the effects of age and lipoic acid supplementation on hepatic gene expression, we fed young (3 months) and old (24 months) male Fischer 344 rats a diet with or without 0.2% (w/w) R-?-lipoic acid (LA) for two weeks. Total RNA isolated from liver tissue was analyzed by Affymetrix microarray to examine changes in transcriptional profile. Results showed an increase in pro-inflammatory gene expression in the aging liver, with increased immune cell function and tissue remodeling genes, representing 45% of the age-related transcriptome changes. Increased inflammation was corroborated by increases in soluble ICAM1 levels with age. There were also observed age-related increases in transcription of genes related to lipid and cholesterol synthesis including Acetyl CoA Carboxylase (Acacb) and Fatty acid Synthase (Fasn). Supplementation of old animals with LA did not reverse this necro-inflammatory phenotype, yet limited age-associated hepatic dyslipidemia. Dietary LA further affected a small but concerted number of hepatic genes regardless of age. These included declines in lipid and bile synthesis genes. Decline in lipid synthesis genes was further corroborated by a decrease in Fasn and Acc protein levels. Intriguingly, LA also altered the expression of genes governing circadian rhythm, most notably Bmal1, Npas2, and Per2, which changed in a coordinated manner with respect to their rhythmic transcription. Thus, advanced age is associated with a necro-inflammatory phenotype and increased lipid synthesis, while chronic LA supplementation influences hepatic genes associated with energy metabolism and circadian rhythm regardless of age. Young (3 months) and old (24 months) Fischer 344 male rats were fed an AIN-93M diet ± 0.2% (w/w) R-?-lipoic acid for two weeks prior to sacrifice. Total RNA was extracted from the median lobe of the liver and analyzed using Affymetrix Rat Genome 230 2.0 Genechips. There were hybridizations for 8 animals in each of the young control, young LA-supplemented, and old control groups, and 6 animals in the old LA-supplemented group. There are only 6 animals in the old LA group because two animals died during the two-week feeding period. This is the reason for nonsequential numbering of animals in this group.

Project description:Bacillus subtilis lacks a recognizable homologue of the LipB octanoyltransferase, an enzyme essential for lipoic acid synthesis in Escherichia coli. LipB transfers the octanoyl moiety from octanoyl-acyl carrier protein to the lipoyl domains of the 2-oxoacid dehydrogenases via a thioester-linked octanoyl-LipB intermediate. The octanoylated dehydrogenase is then converted to the enzymatically active lipoylated species by insertion of two sulfur atoms into the octanoyl moiety by the S-adenosyl-l-methionine radical enzyme, LipA (lipoate synthase). B. subtilis synthesizes lipoic acid and contains a LipA homologue that is fully functional in E. coli. Therefore, the lack of a LipB homologue presented the puzzle of how B. subtilis synthesizes the LipA substrate. We report that B. subtilis encodes an octanoyltransferase that has virtually no sequence resemblance to E. coli LipB but instead has a sequence that resembles that of the E. coli lipoate ligase, LplA. On the basis of this resemblance, these genes have generally been annotated as encoding a lipoate ligase, an enzyme that in E. coli scavenges lipoic acid from the environment but plays no role in de novo synthesis. We have named the B. subtilis octanoyltransferase LipM and find that, like LipB, the LipM reaction proceeds through a thioester-linked acyl enzyme intermediate. The LipM active site nucleophile was identified as C150 by the finding that this thiol becomes modified when LipM is expressed in E. coli. The level of the octanoyl-LipM intermediate can be significantly decreased by blocking fatty acid synthesis during LipM expression, and C150 was confirmed as an essential active site residue by site-directed mutagenesis. LipM homologues seem the sole type of octanoyltransferase present in the firmicutes and are also present in the cyanobacteria. LipM type octanoyltransferases represent a new clade of the PF03099 protein family, suggesting that octanoyl transfer activity has evolved at least twice within this superfamily.

Dataset Information

Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

Publications

Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets