Advances in synthesis of biotin and assembly of lipoic acid.
Ontology highlight
ABSTRACT:
SUBMITTER: Cronan JE
PROVIDER: S-EPMC6289770 | biostudies-literature | 2018 Dec
REPOSITORIES: biostudies-literature
Publications
Advances in synthesis of biotin and assembly of lipoic acid.
Current opinion in chemical biology 20180917
Although biotin and lipoic acid are two universally conserved cofactors essential for intermediary metabolism, their synthetic pathways have become known only in recent years. Both pathways have unusual features. Biotin synthesis in Escherichia coli requires a methylation that is later removed whereas lipoic acid is assembled on the enzymes where it is required for activity by two different pathways. ...[more]
Similar Datasets
Project description:Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein that both represses biotin operon transcription and ligates biotin to its cognate proteins.
| S-EPMC4233344 | biostudies-literature
Project description:For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and ?-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicumIMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis, which use an individual nonaggregating type II fatty acid synthase (FAS-II) system. In this study, we reported genetic evidence demonstrating that the FAS-I system is the source of the biotin precursor in vivo in the engineered biotin-prototrophic C. glutamicum strain. This study also uncovered the important physiological role of FasB in lipoic acid biosynthesis. Here, we present an FAS-I enzyme that functions in supplying the lipoic acid precursor, although its biosynthesis has been believed to exclusively depend on FAS-II in organisms. The findings obtained here provide new insights into the metabolic engineering of this industrially important microorganism to produce these compounds effectively.
| S-EPMC5601351 | biostudies-literature
Project description:Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in ?-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ?-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ?-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.
| S-EPMC4398509 | biostudies-literature
Project description:In the companion paper we reported that Bacillus subtilis requires three proteins for lipoic acid metabolism, all of which are members of the lipoate protein ligase family. Two of the proteins, LipM and LplJ, have been shown to be an octanoyltransferase and a lipoate?:?protein ligase respectively. The third protein, LipL, is essential for lipoic acid synthesis, but had no detectable octanoyltransferase or ligase activity either in vitro or in vivo. We report that LipM specifically modifies the glycine cleavage system protein, GcvH, and therefore another mechanism must exist for modification of other lipoic acid requiring enzymes (e.g. pyruvate dehydrogenase). We show that this function is provided by LipL, which catalyses the amidotransfer (transamidation) of the octanoyl moiety from octanoyl-GcvH to the E2 subunit of pyruvate dehydrogenase. LipL activity was demonstrated in vitro with purified components and proceeds via a thioester-linked acyl-enzyme intermediate. As predicted, ?gcvH strains are lipoate auxotrophs. LipL represents a new enzyme activity. It is a GcvH:[lipoyl domain] amidotransferase that probably uses a Cys-Lys catalytic dyad. Although the active site cysteine residues of LipL and LipB are located in different positions within the polypeptide chains, alignment of their structures show these residues occupy similar positions. Thus, these two homologous enzymes have convergent architectures.
| S-EPMC3088481 | biostudies-literature
Project description:Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression.
| S-EPMC4134263 | biostudies-literature
Project description:Although biotin is an essential enzyme cofactor found in all three domains of life, our knowledge of its biosynthesis remains fragmentary. Most of the carbon atoms of biotin are derived from pimelic acid, a seven-carbon dicarboxylic acid, but the mechanism whereby this intermediate is assembled remains unknown. Genetic analysis in Escherichia coli identified only two genes of unknown function required for pimelate synthesis, bioC and bioH. We report in vivo and in vitro evidence that the pimeloyl moiety is synthesized by a modified fatty acid synthetic pathway in which the omega-carboxyl group of a malonyl-thioester is methylated by BioC, which allows recognition of this atypical substrate by the fatty acid synthetic enzymes. The malonyl-thioester methyl ester enters fatty acid synthesis as the primer and undergoes two reiterations of the fatty acid elongation cycle to give pimeloyl-acyl carrier protein (ACP) methyl ester, which is hydrolyzed to pimeloyl-ACP and methanol by BioH.
| S-EPMC2925990 | biostudies-literature
Project description:Despite the strong anticancer activity of SN38 (7-ethyl-10-hydroxy-camptothecin), the severe side effects and loss of anticancer activity caused by the lack of selectivity to cancer cells and hydrolysis of ring E prevent its clinical application. To address the issue, herein a multifunctional SN38 derivative (compound 9) containing biotin (tumor-targeting group) and valproic acid (histone deacetylase inhibitor, HDACi) was synthesized via click chemistry and evaluated using MTT assay. The in vitro cytotoxicity study showed that compound 9 exhibited superior cytotoxicity than irinotecan against human cervical cancer HeLa cells, albeit it was inferior to SN38. More significantly, compound 9 significantly reduced toxicity in mouse embryonic fibroblast NIH3T3 cells, indicating that compound 9 had the capacity to enhance tumor targeting due to its cell selectivity. Further studies demonstrated that, compared with irinotecan, compound 9 induced similar apoptosis of cancer cells. Consequently, compound 9 can not only improve its tumor-targeting ability mediated by biotin but also exert potent anticancer activity through the effect of SN38 and valproic acid, indicating that the design concept is an effective strategy for the structural modification of SN38.
| S-EPMC10179906 | biostudies-literature
Project description:The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of ?-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepaticparasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analogue 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines.
| S-EPMC3740003 | biostudies-literature
Project description:Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism.
| S-EPMC4867368 | biostudies-literature
Project description:The lack of attachment of lipoic acid to its cognate enzyme proteins results in devastating human metabolic disorders. These mitochondrial disorders are evident soon after birth and generally result in early death. The mutations causing specific defects in lipoyl assembly map in three genes, LIAS, LIPT1, and LIPT2 Although physiological roles have been proposed for the encoded proteins, only the LIPT1 protein had been studied at the enzyme level. LIPT1 was reported to catalyze only the second partial reaction of the classical lipoate ligase mechanism. We report that the physiologically relevant LIPT1 enzyme activity is transfer of lipoyl moieties from the H protein of the glycine cleavage system to the E2 subunits of the 2-oxoacid dehydrogenases required for respiration (e.g., pyruvate dehydrogenase) and amino acid degradation. We also report that LIPT2 encodes an octanoyl transferase that initiates lipoyl group assembly. The human pathway is now biochemically defined.
| S-EPMC6064980 | biostudies-literature