Dataset Information

Isorhapontigenin suppresses growth of patient-derived glioblastoma spheres through regulating miR-145/SOX2/cyclin D1 axis.

ABSTRACT:

Background

Glioblastoma (GBM) is the most common malignant brain tumor, and glioma stem cells (GSCs) are considered a major source of treatment resistance for glioblastoma. Identifying new compounds that inhibit the growth of GSCs and understanding their underlying molecular mechanisms are therefore important for developing novel therapy for GBM.

Methods

We investigated the potential inhibitory effect of isorhapontigenin (ISO), an anticancer compound identified in our recent investigations, on anchorage-independent growth of patient-derived glioblastoma spheres (PDGS) and its mechanism of action.

Results

ISO treatment resulted in significant anchorage-independent growth inhibition, accompanied with cell cycle G0-G1 arrest and cyclin D1 protein downregulation in PDGS. Further studies established that cyclin D1 was downregulated by ISO at transcription levels in a SOX2-dependent manner. In addition, ISO attenuated SOX2 expression by specific induction of miR-145, which in turn suppressed 3'UTR activity of SOX2 mRNA without affecting its mRNA stability. Moreover, ectopic expression of exogenous SOX2 rendered D456 cells resistant to induction of cell cycle G0-G1 arrest and anchorage-independent growth inhibition upon ISO treatment, whereas inhibition of miR-145 resulted in D456 cells resistant to ISO inhibition of SOX2 and cyclin D1 expression. In addition, overexpression of miR-145 mimicked ISO treatment in D456 cells.

Conclusions

ISO induces miR-145 expression, which binds to the SOX2 mRNA 3'UTR region and inhibits SOX2 protein translation. Inhibition of SOX2 leads to cyclin D1 downregulation and PDGS anchorage-independent growth inhibition. The elucidation of the miR-145/SOX2/cyclin D1 axis in PDGS provides a significant insight into understanding the anti-GBM effect of ISO compound.

SUBMITTER: Xu Z

PROVIDER: S-EPMC4864260 | biostudies-literature | 2016 Jun

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Isorhapontigenin suppresses growth of patient-derived glioblastoma spheres through regulating miR-145/SOX2/cyclin D1 axis.

Xu Zhou Z Zeng Xingruo X Xu Jiawei J Xu Derek D Li Jingxia J Jin Honglei H Jiang Guosong G Han Xiaosi X Huang Chuanshu C

Neuro-oncology 20151217 6

<h4>Background</h4>Glioblastoma (GBM) is the most common malignant brain tumor, and glioma stem cells (GSCs) are considered a major source of treatment resistance for glioblastoma. Identifying new compounds that inhibit the growth of GSCs and understanding their underlying molecular mechanisms are therefore important for developing novel therapy for GBM.<h4>Methods</h4>We investigated the potential inhibitory effect of isorhapontigenin (ISO), an anticancer compound identified in our recent inves ...[more]

PMID: 26681767

Similar Datasets

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

Isorhapontigenin suppresses growth of patient-derived glioblastoma spheres through regulating miR-145/SOX2/cyclin D1 axis.

Background

Methods

Results

Conclusions

Publications

Isorhapontigenin suppresses growth of patient-derived glioblastoma spheres through regulating miR-145/SOX2/cyclin D1 axis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets