Dataset Information

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

ABSTRACT: In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

SUBMITTER: Zhang X

PROVIDER: S-EPMC4933378 | biostudies-literature | 2016

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Zhang Xiaobing X Tang Qiaoling Q Wang Xujing X Wang Zhixing Z

PloS one 20160705 7

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton ...[more]

PMID: 27379683

Similar Datasets

Project description:Common bean (Phaseolus vulgaris L.) is a staple food in Brazil with both nutritional and socioeconomic importance. As an orphan crop, it has not received as much research attention as the commodity crops. Crop losses are strongly related to virus diseases transmitted by the whitefly Bemisia tabaci, one of the most important agricultural pests in the world. The main method of managing whitefly-transmitted viruses has been the application of insecticides to reduce vector populations. Compared to chemical vector control, a more sustainable strategy for managing insect-borne viruses is the development of resistant/tolerant cultivars. RNA interference has been applied to develop plant lines resistant to the whitefly in other species, such as tomato, lettuce and tobacco. Still, no whitefly-resistant plant has been made commercially available to date. Common bean is a recalcitrant species to in vitro regeneration; therefore, stable genetic transformation of this plant has been achieved only at low frequencies (<1%) using particle bombardment. In the present work, two transgenic common bean lines were obtained with an intron-hairpin construct to induce post-transcriptional gene silencing against the B. tabaci vATPase (Bt-vATPase) gene, with stable expression of siRNA. Northern blot analysis revealed the presence of bands of expected size for siRNA in leaf samples of the line Bt-22.5, while in the other line (11.5), the amount of siRNA produced was significantly smaller. Bioassays were conducted with both lines, but only the line Bt-22.5 was associated with significant mortality of adult insects (97% when insects were fed on detached leaves and 59% on the whole plant). The expression of the Bt-vATPase gene was 50% lower (p < 0.05) in insects that fed on the transgenic line Bt-22.5, when compared to non-transgenic controls. The transgenic line did not affect the virus transmission ability of the insects. Moreover, no effect was observed on the reproduction of non-target organisms, such as the black aphid Aphis craccivora, the leafminer Liriomyza sp. and the whitefly parasitoid Encarsia formosa. The results presented here serve as a basis for the development of whitefly-tolerant transgenic elite common bean cultivars, with potential to contribute to the management of the whitefly and virus diseases.

Dataset Information

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Publications

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets