Development of non-transgenic glyphosate tolerant wheat by TILLING.
Ontology highlight
ABSTRACT:
SUBMITTER: Moehs CP
PROVIDER: S-EPMC8443057 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:Wheat is one of the most widely grown cereal crops in the world and is an important food grain source for humans. However, wheat yields can be reduced by many abiotic and biotic stress factors, including powdery mildew disease caused by Blumeria graminis f.sp. tritici (Bgt). Generating resistant varieties is thus a major effort in plant breeding. Here, we took advantage of the non-transgenic Targeting Induced Lesions IN Genomes (TILLING) technology to select partial loss-of-function alleles of TaMlo, the orthologue of the barley Mlo (Mildew resistance locus o) gene. Natural and induced loss-of-function alleles (mlo) of barley Mlo are known to confer durable broad-spectrum powdery mildew resistance, typically at the expense of pleiotropic phenotypes such as premature leaf senescence. We identified 16 missense mutations in the three wheat TaMlo homoeologues, TaMlo-A1, TaMlo-B1 and TaMlo-D1 that each lead to single amino acid exchanges. Using transient gene expression assays in barley single cells, we functionally analysed the different missense mutants and identified the most promising candidates affecting powdery mildew susceptibility. By stacking of selected mutant alleles we generated four independent lines with non-conservative mutations in each of the three TaMlo homoeologues. Homozygous triple mutant lines and surprisingly also some of the homozygous double mutant lines showed enhanced, yet incomplete, Bgt resistance without the occurrence of discernible pleiotropic phenotypes. These lines thus represent an important step towards the production of commercial non-transgenic, powdery mildew-resistant bread wheat varieties.
| S-EPMC5316926 | biostudies-literature
Project description:BackgroundWheat (Triticum spp.) is an important source of food worldwide and the focus of considerable efforts to identify new combinations of genetic diversity for crop improvement. In particular, wheat starch composition is a major target for changes that could benefit human health. Starches with increased levels of amylose are of interest because of the correlation between higher amylose content and elevated levels of resistant starch, which has been shown to have beneficial effects on health for combating obesity and diabetes. TILLING (Targeting Induced Local Lesions in Genomes) is a means to identify novel genetic variation without the need for direct selection of phenotypes.ResultsUsing TILLING to identify novel genetic variation in each of the A and B genomes in tetraploid durum wheat and the A, B and D genomes in hexaploid bread wheat, we have identified mutations in the form of single nucleotide polymorphisms (SNPs) in starch branching enzyme IIa genes (SBEIIa). Combining these new alleles of SBEIIa through breeding resulted in the development of high amylose durum and bread wheat varieties containing 47-55% amylose and having elevated resistant starch levels compared to wild-type wheat. High amylose lines also had reduced expression of SBEIIa RNA, changes in starch granule morphology and altered starch granule protein profiles as evaluated by mass spectrometry.ConclusionsWe report the use of TILLING to develop new traits in crops with complex genomes without the use of transgenic modifications. Combined mutations in SBEIIa in durum and bread wheat varieties resulted in lines with significantly increased amylose and resistant starch contents.
| S-EPMC3424102 | biostudies-literature
Project description:BACKGROUND:Triticum monococcum L., an A genome diploid einkorn wheat, was the first domesticated crop. As a diploid, it is attractive genetic model for the study of gene structure and function of wheat-specific traits. Diploid wheat is currently not amenable to reverse genetics approaches such as insertion mutagenesis and post-transcriptional gene silencing strategies. However, TILLING offers a powerful functional genetics approach for wheat gene analysis. RESULTS:We developed a TILLING population of 1,532 M2 families using EMS as a mutagen. A total of 67 mutants were obtained for the four genes studied. Waxy gene mutation frequencies are known to be 1/17.6 - 34.4 kb DNA in polyploid wheat TILLING populations. The T. monococcum diploid wheat TILLING population had a mutation frequency of 1/90 kb for the same gene. Lignin biosynthesis pathway genes- COMT1, HCT2, and 4CL1 had mutation frequencies of 1/86 kb, 1/92 kb and 1/100 kb, respectively. The overall mutation frequency of the diploid wheat TILLING population was 1/92 kb. CONCLUSION:The mutation frequency of a diploid wheat TILLING population was found to be higher than that reported for other diploid grasses. The rate, however, is lower than tetraploid and hexaploid wheat TILLING populations because of the higher tolerance of polyploids to mutations. Unlike polyploid wheat, most mutants in diploid wheat have a phenotype amenable to forward and reverse genetic analysis and establish diploid wheat as an attractive model to study gene function in wheat. We estimate that a TILLING population of 5, 520 will be needed to get a non-sense mutation for every wheat gene of interest with 95% probability.
| S-EPMC3541219 | biostudies-literature
Project description:Glyphosate is the most widely used herbicide for its low cost and high efficiency. However, it is rarely applied directly in rice field due to its toxicity to rice. Therefore, glyphosate-tolerant rice can greatly decrease the cost of rice production and provide a more effective weed management strategy. Although, several approaches to develop transgenic rice with glyphosate tolerance have been reported, the agronomic performances of these plants have not been well evaluated, and the feasibility of commercial production has not been confirmed yet. Here, a novel glyphosate-tolerant gene cloned from the bacterium Isoptericola variabilis was identified, codon optimized (designated as I. variabilis-EPSPS (*)), and transferred into Zhonghua11, a widely used japonica rice cultivar. After systematic analysis of the transgene integration via PCR, Southern blot and flanking sequence isolation, three transgenic lines with only one intact I. variabilis-EPSPS (*) expression cassette integrated into intergenic regions were identified. Seed test results showed that the glyphosate tolerance of the transgenic rice was about 240 times that of wild type on plant medium. The glyphosate tolerance of transgenic rice lines was further evaluated based on comprehensive agronomic performances in the field with T3 and T5generations in a 2-year assay, which showed that they were rarely affected by glyphosate even when the dosage was 8400 g ha(-1). To our knowledge, this is the first demonstration of the development of glyphosate-tolerant rice lines based on a comprehensive analysis of agronomic performances in the field. Taken together, the results suggest that the selected glyphosate-tolerant rice lines are highly tolerant to glyphosate and have the possibility of commercial release. I. variabilis-EPSPS (*) also can be a promising candidate gene in other species for developing glyphosate-tolerant crops.
| S-EPMC5003930 | biostudies-literature
Project description:In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
| S-EPMC4933378 | biostudies-literature
Project description:Mutagenesis is an important tool in crop improvement. However, the hexaploid genome of wheat (Triticum aestivum L.) presents problems in identifying desirable genetic changes based on phenotypic screening due to gene redundancy. TILLING (Targeting Induced Local Lesions IN Genomes), a powerful reverse genetic strategy that allows the detection of induced point mutations in individuals of the mutagenized populations, can address the major challenge of linking sequence information to the biological function of genes and can also identify novel variation for crop breeding. Wheat is especially well-suited for TILLING due to the high mutation densities tolerated by polyploids. However, only a few wheat TILLING populations are currently available in the world, which is far from satisfying the requirement of researchers and breeders in different growing environments. In addition, current TILLING screening protocols require costly fluorescence detection systems, limiting their use, especially in developing countries. We developed a new TILLING resource comprising 2610 M(2) mutants in a common wheat cultivar 'Jinmai 47'. Numerous phenotypes with altered morphological and agronomic traits were observed from the M(2) and M(3) lines in the field. To simplify the procedure and decrease costs, we use unlabeled primers and either non-denaturing polyacrylamide gels or agarose gels for mutation detection. The value of this new resource was tested using PCR with RAPD and Intron-spliced junction (ISJ) primers, and also TILLING in three selected candidate genes, in 300 and 512 mutant lines, revealing high mutation densities of 1/34 kb by RAPD/ISJ analysis and 1/47 kb by TILLING. In total, 31 novel alleles were identified in the 3 targeted genes and confirmed by sequencing. The results indicate that this mutant population represents a useful resource for the wheat research community. We hope that the use of this reverse genetics resource will provide novel allelic diversity for wheat improvement and functional genomics.
| S-EPMC3402408 | biostudies-literature
Project description:Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. Growth-chamber studies demonstrated wheat rust control at multiple plant growth stages with a glyphosate spray dose typically recommended for weed control. Rust control was absent in formulation controls without glyphosate, dependent on systemic glyphosate concentrations in leaf tissues, and not mediated through induction of four common systemic acquired resistance genes. A field test with endemic stripe rust inoculum confirmed the activities of glyphosate pre- and postinfestation. Preliminary greenhouse studies also demonstrated that application of glyphosate in glyphosate-resistant soybeans suppressed Asian soybean rust, caused by Phakopsora pachyrhizi.
| S-EPMC1297694 | biostudies-literature
Project description:Macro- and micronutrients, essential for the maintenance of human metabolism, are assimilated daily through the diet. Wheat and other major cereals are a good source of nutrients, such as carbohydrates and proteins, but cannot supply a sufficient amount of essential micronutrients, including provitamin A. As vitamin A deficiency (VAD) leads to several serious diseases throughout the world, the biofortification of a major staple crop, such as wheat, represents an effective way to preserve human health in developing countries. In the present work, a key enzyme involved in the branch of carotenoids pathway producing ?-carotene, lycopene epsilon cyclase, has been targeted by a Targeting Induced Local Lesions in Genomes (TILLING) approach in a "block strategy" perspective. The null mutant genotype showed a strong reduction in the expression of the lcyE gene and also interesting pleiotropic effects on an enzyme (?-ring hydroxylase) acting downstream in the pathway. Biochemical profiling of carotenoids in the wheat mutant lines showed an increase of roughly 75% in ?-carotene in the grains of the complete mutant line compared with the control. In conclusion, we describe here the production and characterization of a new wheat line biofortified with provitamin A obtained through a nontransgenic approach, which also sheds new light on the molecular mechanism governing carotenoid biosynthesis in durum wheat.
| S-EPMC6888361 | biostudies-literature
Project description:The worldwide demand for natural bast fibers is met aptly by the long, golden and silky fibers of jute. This highest bast fiber producing crop is of great applicability and is extensively used in paper and textile industry. Macrophomina phaseolina (Tassi) Goid is a severely devastating necrotrophic fungal pathogen causing stem rot, root rot, and charcoal rot diseases in both the cultivated species of jute - Corchorus capsularis and Corchorus olitorius. Another major problem faced in jute cultivation is profuse weed infestation in the fields. Huge losses in quality fiber production is caused by this pathogenic fungi and cultivation cost increases as well due to weed management expenditure during cropping season. To solve these long persisting jute cultivation challenges, the chitinase (chi11) gene (to provide fungus resistance) and the bar gene (to provide herbicide tolerance) have been incorporated in C. capsularis JRC-321 via Agrobacterium transformation and analyzed up to T2 generation. Stable integration and expression of these two genes in the jute genome was confirmed upon extensive analyses. Transgenic plants showed higher chitinase expression and chitin degrading activity than non-transgenic control plants. Antifungal activity significantly increased in transgenic plants as confirmed by detached leaf and whole plant M. phaseolina bioassay. Herbicide tolerance was analyzed by growing transgenic plants in 10 mg/l glufosinate ammonium containing media and by spraying 0.25% (v/v) glufosinate herbicide Basta® on them. Assessment of residual phytotoxicity effects of Basta® on soil confirmed no negative impact on growth of indicator plants corn and cucumber. Transgenic jute plants were at par with non-transgenic (control) jute plants in all phenotypic aspects. Non-transgenic (control) jute plants suffered significant losses in fiber yield and quality due to M. phaseolina infection whereas the transgenic lines maintained the quality of fiber even after the infection.
| S-EPMC6048421 | biostudies-literature
Project description:BACKGROUND: Trait purity is a key factor for the successful utilization of biotech varieties and is currently assessed by analysis of individual seeds or plants. Here we propose a novel PCR-based approach to test trait purity that can be applied to bulk samples. To this aim the insertion site of a transgene is characterized and the corresponding sequence of the wild-type (wt) allele is used as diagnostic target for amplification. As a demonstration, we developed a real-time quantitative PCR method to test purity of glyphosate tolerant (Roundup Ready, RR) soybean. RESULTS: The soybean wt sequence at the RR locus was characterized and found to be highly conserved among conventional genotypes, thus allowing the detection of possibly any soybean non-trait contaminant. On the other hand, no amplification product was obtained from RR soybean varieties, indicating that the wt sequence is single copy and represents a suitable marker of conventional soybean presence. In addition, results obtained from the analysis of wt-spiked RR samples demonstrate that it is possible to use the real-time PCR assay to quantify the non-trait contamination with an acceptable degree of accuracy. CONCLUSION: In principle this approach could be successfully applied to any transgenic event, provided that the wild-type sequence is conserved and single copy. The main advantages of the assay here described derive from its applicability to bulk samples, which would allow to increase the number of single seeds or plants forming the analytical sample, thus improving accuracy and throughput while containing costs. For these reasons this application of quantitative PCR could represent a useful tool in agricultural biotechnology.
| S-EPMC2656496 | biostudies-literature