Browse
Submit Data
Databases
API
Help

Dataset Information

14 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptional regulation of the proto-oncogene Zfp521 by SPI1 (PU.1) and HOXC13.

ABSTRACT: The mouse zinc-finger gene Zfp521 (also known as ecotropic viral insertion site 3; Evi3; and ZNF521 in humans) has been identified as a B-cell proto-oncogene, causing leukemia in mice following retroviral insertions in its promoter region that drive Zfp521 over-expression. Furthermore, ZNF521 is expressed in human hematopoietic cells, and translocations between ZNF521 and PAX5 are associated with pediatric acute lymphoblastic leukemia. However, the regulatory factors that control Zfp521 expression directly have not been characterized. Here we demonstrate that the transcription factors SPI1 (PU.1) and HOXC13 synergistically regulate Zfp521 expression, and identify the regions of the Zfp521 promoter required for this transcriptional activity. We also show that SPI1 and HOXC13 activate Zfp521 in a dose-dependent manner. Our data support a role for this regulatory mechanism in vivo, as transgenic mice over-expressing Hoxc13 in the fetal liver show a strong correlation between Hoxc13 expression levels and Zfp521 expression. Overall these experiments provide insights into the regulation of Zfp521 expression in a nononcogenic context. The identification of transcription factors capable of activating Zfp521 provides a foundation for further investigation of the regulatory mechanisms involved in ZFP521-driven cell differentiation processes and diseases linked to Zfp521 mis-expression.

SUBMITTER: Yu M

PROVIDER: S-EPMC5073027 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Pioneering, chromatin remodeling, and epigenetic constraint in early T-cell gene regulation by SPI1 (PU.1).

Project description:SPI1 (also known as PU.1) is a dominant but transient regulator in early T-cell precursors and a potent transcriptional controller of developmentally important pro-T-cell genes. Before T-lineage commitment, open chromatin is frequently occupied by PU.1, and many PU.1 sites lose accessibility when PU.1 is later down-regulated. Pioneering activity of PU.1 was tested in this developmentally dynamic context by quantitating the relationships between PU.1 occupancy and site quality and accessibility as PU.1 levels naturally declined in pro-T-cell development and by using stage-specific gain- and loss-of-function perturbations to relate binding to effects on target genes. PU.1 could bind closed genomic sites, but rapidly opened many of them, despite the absence of its frequent collaborator, CEBPA. RUNX motifs and RUNX1 binding were often linked to PU.1 at open sites, but highly expressed PU.1 could bind its sites without RUNX1. The dynamic properties of PU.1 engagements implied that PU.1 binding affinity and concentration determine its occupancy choices, but with quantitative trade-offs for occupancy between site sequence quality and stage-dependent site accessibility in chromatin. At nonpromoter sites, PU.1 binding criteria were more stringent than at promoters, and PU.1 was also much more effective as a transcriptional regulator at nonpromoter sites where local chromatin accessibility depended on the presence of PU.1. Notably, closed chromatin presented a qualitative barrier to occupancy by the PU.1 DNA-binding domain alone. Thus, effective pioneering at closed chromatin sites also depends on requirements beyond site recognition, served by non-DNA-binding domains of PU.1.

| S-EPMC6169891 | biostudies-literature

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

Project description:G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

| S-EPMC6408435 | biostudies-literature

An in vitro approach to test the possible role of candidate factors in the transcriptional regulation of the RET proto-oncogene.

Project description:Neural crest cells arise from the epithelium of the dorsal neural tube and migrate to various districts giving origin, among others, to sympathetic, parasympathetic, and enteric ganglia. It has been shown that the transcription factors HOX11L1, HOX11L2, MASH1, PHOX2A, and PHOX2B are all necessary, to various extents, to the correct development of the autonomic nervous system. To investigate their possible role in the transcriptional regulation of the RET proto-oncogene, a gene playing a crucial role in correct intestinal innervation, we undertook a specific in vitro experimental strategy. Two neuroblastoma cell lines (SK-N-MC and SK-N-BE) were cotransfected with each transcription factor expressing plasmids and sequential deletion constructs of the 5' c-RET flanking region cloned upstream of the Luciferase reporter gene. Here we show that HOX11L1 enhances the activity of the c-RET promoter in SK-N-MC cell line by stimulating a region between -166 bp and -35 bp. Gel shift assays performed with oligonucleotides spanning this promoter sequence showed a change of the SP1 interaction with its binding sites, consequent to transfection with HOX11L1. While HOX11L2 showed no effect in both the cell lines, we have observed PHOX2A, PHOX2B, and MASH1 triggering a reproducible increase in the Luciferase activity in SK-N-BE cell line. A sequence responsible of the PHOX2A-dependent activation has been identified, while PHOX2B seems to act indirectly, as no physical binding has been demonstrated on c-RET promoter.

| S-EPMC6009117 | biostudies-literature

PIM3 proto-oncogene kinase is a common transcriptional target of divergent EWS/ETS oncoproteins.

Project description:Despite significant structural diversity, present evidence suggests that EWS/ETS fusion proteins promote oncogenesis by transcriptionally modulating a common set of target genes. In order to identify these genes, microarray expression analyses were performed on NIH 3T3 polyclonal populations expressing one of three EWS/ETS fusion genes. The majority of these genes can be grouped into seven functional categories, including cellular metabolism and signal transduction. The biologic significance of these target genes was pursued. The effects of modulating genes involved in metabolism were assessed by flux studies and demonstrated shifts in glucose utilization and lactate production as a result of EWS/FLI1 expression. The proto-oncogene coding for serine/threonine kinase PIM3 was found to one of several genes encoding signal transduction proteins that were up-regulated by EWS/ETS fusions. PIM3 was found to be expressed in a panel of human Ewing's family tumor cell lines. Forced expression of PIM3 promoted anchorage-independent growth. Coexpression of a kinase-deficient PIM3 mutant attenuated EWS/FLI1-mediated NIH 3T3 tumorigenesis in immunodeficent mice.

| S-EPMC155223 | biostudies-literature

MALAT1 regulates the transcriptional and translational levels of proto-oncogene RUNX2 in colorectal cancer metastasis.

Project description:Ectopic expression of lncRNA-MALAT1 has been discovered in recurrent colorectal cancer (CRC) and metastatic sites in postsurgical patients, however, its biological mechanism remained unelucidated. Our study first revealed the novel roles of MALAT1 in promoting CRC metastasis through two mechanisms: first, MALAT1 binds miR-15 family members, to "de-inhibit" their effect on LRP6 expression, enhances ?-catenin signaling, leading to elevated transcriptional levels of downstream target genes RUNX2. Second, MALAT1 binds SFPQ, and dissociates SFPQ/PTBP2 dimer to release free PTBP2, which elevates translational levels of RUNX2, through interacting with IRES domain in the 5'UTR of the corresponding RUNX2 mRNAs. Moreover, increased RUNX2 expression levels were detected in recurrent CRC tumors, which were closely associated with TMN stages, metastasis, as well as CRC patients' survival. Our study demonstrated that MALAT1 and RUNX2 may serve as two biomarkers for predicting the recurrence and metastasis of CRC patients.

| S-EPMC6522477 | biostudies-literature

Molecular evolution of the Yap/Yorkie proto-oncogene and elucidation of its core transcriptional program.

Project description:Throughout Metazoa, developmental processes are controlled by a surprisingly limited number of conserved signaling pathways. Precisely how these signaling cassettes were assembled in early animal evolution remains poorly understood, as do the molecular transitions that potentiated the acquisition of their myriad developmental functions. Here we analyze the molecular evolution of the proto-oncogene yes-associated protein (Yap)/Yorkie, a key effector of the Hippo signaling pathway that controls organ size in both Drosophila and mammals. Based on heterologous functional analysis of evolutionarily distant Yap/Yorkie orthologs, we demonstrate that a structurally distinct interaction interface between Yap/Yorkie and its partner TEAD/Scalloped became fixed in the eumetazoan common ancestor. We then combine transcriptional profiling of tissues expressing phylogenetically diverse forms of Yap/Yorkie with ChIP-seq validation to identify a common downstream gene expression program underlying the control of tissue growth in Drosophila. Intriguingly, a subset of the newly identified Yorkie target genes are also induced by Yap in mammalian tissues, thus revealing a conserved Yap-dependent gene expression signature likely to mediate organ size control throughout bilaterian animals. Combined, these experiments provide new mechanistic insights while revealing the ancient evolutionary history of Hippo signaling.

| S-EPMC4032125 | biostudies-literature

Transcriptional activation of cKi-ras proto-oncogene resulting from retroviral promoter insertion.

Project description:Enhanced expression of the cKi-ras proto-oncogene in a bone marrow-derived mouse cell line, 416B, has been shown to be associated with the integration of Friend viral DNA into the cellular gene. Here we report the results of experiments designed to clarify the molecular mechanism responsible for the cKi-ras overexpression. Based on primer extension analyses and DNA sequencing of cKi-ras cDNA clones, we have obtained evidence that the 416B cells contain viral-host chimaeric transcripts that initiate within the 3' long terminal repeat (LTR) of the integrated provirus. Processing of the transcripts from the rearranged cKi-ras gene includes an unexpected splicing event associated with the fortuitous creation of a cryptic donor splice site at the junction between the proviral and cellular DNA sequences. These data demonstrate that enhanced cKi-ras expression in the 416B cells results from a retroviral promoter insertion mechanism of transcriptional activation.

| S-EPMC335129 | biostudies-other

Regulation of B versus T lymphoid lineage fate decision by the proto-oncogene LRF.

Project description:Hematopoietic stem cells in the bone marrow give rise to lymphoid progenitors, which subsequently differentiate into B and T lymphocytes. Here we show that the proto-oncogene LRF plays an essential role in the B versus T lymphoid cell-fate decision. We demonstrate that LRF is key for instructing early lymphoid progenitors in mice to develop into B lineage cells by repressing T cell-instructive signals produced by the cell-fate signal protein, Notch. We propose a new model for lymphoid lineage commitment, in which LRF acts as a master regulator of the cell's determination of B versus T lineage.

| S-EPMC2978506 | biostudies-literature

Coordinated transcriptional regulation of bone homeostasis by Ebf1 and Zfp521 in both mesenchymal and hematopoietic lineages.

Project description:Bone homeostasis is maintained by the coupled actions of hematopoietic bone-resorbing osteoclasts (OCs) and mesenchymal bone-forming osteoblasts (OBs). Here we identify early B cell factor 1 (Ebf1) and the transcriptional coregulator Zfp521 as components of the machinery that regulates bone homeostasis through coordinated effects in both lineages. Deletion of Zfp521 in OBs led to impaired bone formation and increased OB-dependent osteoclastogenesis (OC-genesis), and deletion in hematopoietic cells revealed a strong cell-autonomous role for Zfp521 in OC progenitors. In adult mice, the effects of Zfp521 were largely caused by repression of Ebf1, and the bone phenotype of Zfp521(+/-) mice was rescued in Zfp521(+/-):Ebf1(+/-) mice. Zfp521 interacted with Ebf1 and repressed its transcriptional activity. Accordingly, deletion of Zfp521 led to increased Ebf1 activity in OBs and OCs. In vivo, Ebf1 overexpression in OBs resulted in suppressed bone formation, similar to the phenotype seen after OB-targeted deletion of Zfp521. Conversely, Ebf1 deletion led to cell-autonomous defects in both OB-dependent and cell-intrinsic OC-genesis, a phenotype opposite to that of the Zfp521 knockout. Thus, we have identified the interplay between Zfp521 and Ebf1 as a novel rheostat for bone homeostasis.

| S-EPMC3646489 | biostudies-literature

Screening of mutations in the additional sex combs like 1, transcriptional regulator, tumor protein p53, and KRAS proto-oncogene, GTPase/NRAS proto-oncogene, GTPase genes of patients with myelodysplastic syndrome.

Project description:Myelodysplastic syndrome (MDS) is a heterogeneous group of clonal bone marrow disorders characterized by ineffective hematopoiesis, different degrees of cellular dysplasia, and increased risk of progression to acute myeloid leukemia. International Prognostic Scoring System is the gold standard for MDS classification; however, patients exhibiting different clinical behaviors often coexist in the same group, indicating that the currently available scoring systems are insufficient. The genes that have recently been identified as mutated in MDS, including additional sex combs like 1, transcriptional regulator (ASXL1), tumor protein p53 (TP53), and KRAS proto-oncogene and GTPase (KRAS)/NRAS proto-oncogene, GTPase (NRAS), may contribute to a more comprehensive classification, as well as to the prognosis and progression of the disease. In the present study, the mutations in the ASXL1, TP53 and NRAS/KRAS genes in 50 patients were evaluated by sequencing genomic bone marrow DNA. Nine patients (18%) presented with at least one type of mutation. Mutations in TP53 were the most frequent in six patients (12%), followed by ASXL1 in two patients (4%) and NRAS in one patient (2%). The nine mutations were detected in patients with low- and high-risk MDS. The screening of mutations in MDS cases contributes to the application of personalized medicine.

| S-EPMC5590036 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data