Dataset Information

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

ABSTRACT: G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand c? can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

SUBMITTER: Cui X

PROVIDER: S-EPMC6408435 | biostudies-literature | 2019 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:In human and mouse, the promoter of the KRAS gene contains a nuclease hypersensitive polypurine-polypyrimidine element (NHPPE) that is essential for transcription. An interesting feature of the polypurine G-rich strand of NHPPE is its ability to assume an unusual DNA structure that, according to circular dichroism (CD) and DMS footprinting experiments, is attributed to an intramolecular parallel G-quadruplex, consisting of three G-tetrads and three loops. The human and mouse KRAS NHPPE G-rich strands display melting temperature of 64 and 73 degrees C, respectively, as well as a K+-dependent capacity to arrest DNA polymerase. Photocleavage and CD experiments showed that the cationic porphyrin TMPyP4 stacks to the external G-tetrads of the KRAS quadruplexes, increasing the T(m) by approximately 20 degrees C. These findings raise the intriguing question that the G-quadruplex formed within the NHPPE of KRAS may be involved in the regulation of transcription. Indeed, transfection experiments showed that the activity of the mouse KRAS promoter is reduced to 20% of control, in the presence of the quadruplex-stabilizing TMPyP4. In addition, we found that G-rich oligonucleotides mimicking the KRAS quadruplex, but not the corresponding 4-base mutant sequences or oligonucleotides forming quadruplexes with different structures, competed with the NHPPE duplex for binding to nuclear proteins. When vector pKRS-413, containing CAT driven by the mouse KRAS promoter, and KRAS quadruplex oligonucleotides were co-transfected in 293 cells, the expression of CAT was found to be downregulated to 40% of the control. On the basis of these data, we propose that the NHPPE of KRAS exists in equilibrium between a double-stranded form favouring transcription and a folded quadruplex form, which instead inhibits transcription. Such a mechanism, which is probably adopted by other growth-related genes, provides useful hints for the rational design of anticancer drugs against the KRAS oncogene.

Dataset Information

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets