Unknown

Dataset Information

0

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.


ABSTRACT: G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

SUBMITTER: Cui X 

PROVIDER: S-EPMC6408435 | biostudies-literature | 2019 Mar

REPOSITORIES: biostudies-literature

altmetric image

Publications

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

Cui Xiaojie X   Chen Han H   Zhang Qiang Q   Xu Ming M   Yuan Gu G   Zhou Jiang J  

Scientific reports 20190308 1


G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further eviden  ...[more]

Similar Datasets

| S-EPMC5427283 | biostudies-literature
| S-EPMC6234227 | biostudies-literature
| S-EPMC1459413 | biostudies-literature
| S-EPMC5073027 | biostudies-literature
| S-EPMC335129 | biostudies-other
| S-EPMC3159441 | biostudies-literature
| S-EPMC3962748 | biostudies-literature
| S-EPMC4118953 | biostudies-literature
| S-EPMC2206252 | biostudies-literature
| S-EPMC6185859 | biostudies-literature