Dataset Information

Ratio of mutated versus wild-type coat protein sequences in Pepino mosaic virus determines the nature and severity of yellowing symptoms on tomato plants.

ABSTRACT: Recently, Pepino mosaic virus (PepMV) infections causing severe yellowing symptoms in tomato plants have been reported in glasshouse tomato crops. When studying this phenomenon in commercial glasshouses, two different types of yellowing symptoms, occurring in adjacent plants, were distinguished: interveinal leaf yellowing and yellow mosaics. After several weeks, the interveinal leaf yellowing symptoms gradually disappeared and the plant heads became green again, with yellow mosaic patterns on the leaves as an intermediate stage. The sequencing of multiple isolates causing interveinal leaf yellowing identified two point mutations, occurring in positions 155 and 166 of the coat protein (CP), as unique to the yellowing pathotype. Site-directed mutagenesis of infectious clones confirmed that both CP mutations are determinants of the interveinal leaf yellowing symptoms. Sequencing of CP clones from plants or plant parts with the yellow mosaic symptoms resulted in a mixture of wild-type and mutated sequences, whereas sequencing of CP clones from the green heads of recovered plants resulted in only wild-type sequences. Yellow mosaic symptoms could be reproduced by inoculation of an artificial 1:1 mixture of RNA transcripts from the wild-type and mutated infectious clones. These results show that the ratio of mutated versus wild-type sequences can determine the nature and severity of symptom development. The gradual recovery of the plants, which coincides with the disappearance of the yellowing mutations, suggests that selection pressure acts to the advantage of the wild-type virus. Experiments with wild-type and mutated infectious clones showed that reverse mutation events from mutant to wild-type occur and that the wild-type virus does not have a replicative advantage over the mutant. These results suggest that reverse mutation events occur, with subsequent selection pressure acting in favour of the wild-type virus in the growing plant parts, possibly related to a lower long-distance movement efficiency of the mutant.

SUBMITTER: Hasiow-Jaroszewska B

PROVIDER: S-EPMC6638792 | biostudies-literature | 2013 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Ratio of mutated versus wild-type coat protein sequences in Pepino mosaic virus determines the nature and severity of yellowing symptoms on tomato plants.

Hasiów-Jaroszewska Beata B Paeleman Anneleen A Ortega-Parra Nelia N Borodynko Natasza N Minicka Julia J Czerwoniec Anna A Thomma Bart P H J BP Hanssen Inge M IM

Molecular plant pathology 20130715 9

Recently, Pepino mosaic virus (PepMV) infections causing severe yellowing symptoms in tomato plants have been reported in glasshouse tomato crops. When studying this phenomenon in commercial glasshouses, two different types of yellowing symptoms, occurring in adjacent plants, were distinguished: interveinal leaf yellowing and yellow mosaics. After several weeks, the interveinal leaf yellowing symptoms gradually disappeared and the plant heads became green again, with yellow mosaic patterns on th ...[more]

PMID: 23855964

Similar Datasets

Project description:TAXONOMY:Pepino mosaic virus (PepMV) belongs to the Potexvirus genus of the Flexiviridae family. PHYSICAL PROPERTIES:PepMV virions are nonenveloped flexuous rods that contain a monopartite, positive-sense, single-stranded RNA genome of 6.4 kb with a 3' poly-A tail. The genome contains five major open reading frames (ORFs) encoding a 164-kDa RNA-dependent RNA polymerase (RdRp), three triple gene block proteins of 26, 14 and 9 kDa, and a 25-kDa coat protein. GENOME DIVERSITY:Four PepMV genotypes, with an intergenotype RNA sequence identity ranging from 78% to 95%, can be distinguished: the original Peruvian genotype (LP); the European (tomato) genotype (EU); the American genotype US1; and the Chilean genotype CH2. TRANSMISSION:PepMV is very efficiently transmitted mechanically, and a low seed transmission rate has been demonstrated. In addition, bumblebees have been associated with viral transmission. HOST RANGE:Similar to other Potexviruses, PepMV has a rather narrow host range that is thought to be largely restricted to species of the Solanaceae family. After originally being isolated from pepino (Solanum muricatum), PepMV has been identified in natural infections of the wild tomato species S. chilense, S. chmielewskii, S. parviflorum and S. peruvianum. PepMV is causing significant problems in the cultivation of the glasshouse tomato Solanum lycopersicum, and has been identified in weeds belonging to various plant families in the vicinity of tomato glasshouses. SYMPTOMATOLOGY:PepMV symptoms can be very diverse. Fruit marbling is the most typical and economically devastating symptom. In addition, fruit discoloration, open fruit, nettle-heads, leaf blistering or bubbling, leaf chlorosis and yellow angular leaf spots, leaf mosaic and leaf or stem necrosis have been associated with PepMV. The severity of PepMV symptoms is thought to be dependent on environmental conditions, as well as on the properties of the viral isolate. Minor nucleotide sequence differences between isolates from the same genotype have been shown to lead to enhanced aggressiveness and symptomatology. CONTROL:Prevention of infection through strict hygiene measures is currently the major strategy for the control of PepMV in tomato production. Cross-protection can be effective, but only under well-defined and well-controlled conditions, and the effectiveness depends strongly on the PepMV genotype.

Project description:BackgroundVectors based on plant viruses are important tools for functional genomics, cellular biology, plant genome engineering and molecular farming. We previously reported on the construction of PepGFP2a, a viral vector based on pepino mosaic virus (PepMV) which expressed GFP efficiently and stably in plants of its experimental host Nicotiana benthamiana, but not in its natural host tomato. We have prepared a new set of PepMV-based vectors with improved stability that are able to express a wide range of reporter genes, useful for both N. benthamiana and tomato.ResultsWe first tested PepGFPm1 and PepGFPm2, two variants of PepGFP2a in which we progressively reduced a duplication of nucleotides encoding the N-terminal region of the coat protein. The new vectors had improved GFP expression levels and stability in N. benthamiana but not in tomato plants. Next, we replaced GFP by DsRed or mCherry in the new vectors PepDsRed and PepmCherry, respectively; while PepmCherry behaved similarly to PepGFPm2, PepDsRed expressed the reporter gene efficiently also in tomato plants. We then used PepGFPm2 and PepDsRed to study the PepMV localization in both N. benthamiana and tomato cells. Using confocal laser scanning microscopy (CLSM), we observed characteristic fluorescent bodies in PepMV-infected cells; these bodies had a cytoplasmic localization and appeared in close proximity to the cell nucleus. Already at 3 days post-agroinoculation there were fluorescent bodies in almost every cell of agroinoculated tissues of both hosts, and always one body per cell. When markers for the endoplasmic reticulum or the Golgi apparatus were co-expressed with PepGFPm2 or PepDsRed, a reorganisation of these organelles was observed, with images suggesting that both are intimately related but not the main constituents of the PepMV bodies. Altogether, this set of data suggested that the PepMV bodies are similar to the potato virus X (PVX) "X-bodies", which have been described as the PVX viral replication complexes (VRCs). To complete the set of PepMV-based vectors, we constructed a vector expressing the BAR herbicide resistance gene, useful for massive susceptibility screenings.ConclusionsWe have significantly expanded the PepMV tool box by producing a set of new vectors with improved stability and efficiency in both N. benthamiana and tomato plants. By using two of these vectors, we have described characteristic cellular bodies induced by PepMV infection; these bodies are likely the PepMV VRCs.

Project description:Plant and virus materials, inoculation and symptom evaluation Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA). Microarray sample preparation and determination of viral titers Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

Project description:Virus emergence is a complex phenomenon, which generally involves spread to a new host from a wild host, followed by adaptation to the new host. Although viruses account for the largest fraction of emerging crop pathogens, knowledge about their emergence is incomplete. We address here the question of whether Pepino Mosaic Virus (PepMV) emergence as a major tomato pathogen worldwide could have involved spread from wild to cultivated plant species and host adaptation. For this, we surveyed natural populations of wild tomatoes in southern Peru for PepMV infection. PepMV incidence, genetic variation, population structure, and accumulation in various hosts were analyzed. PepMV incidence in wild tomatoes was high, and a strain not yet reported in domestic tomato was characterized. This strain had a wide host range within the Solanaceae, multiplying efficiently in most assayed Solanum species and being adapted to wild tomato hosts. Conversely, PepMV isolates from tomato crops showed evidence of adaptation to domestic tomato, possibly traded against adaptation to wild tomatoes. Phylogenetic reconstructions indicated that the most probable ancestral sequence came from a wild Solanum species. A high incidence of PepMV in wild tomato relatives would favor virus spread to crops and its efficient multiplication in different Solanum species, including tomato, allowing its establishment as an epidemic pathogen. Later, adaptation to tomato, traded off against adaptation to other Solanum species, would isolate tomato populations from those in other hosts.Virus emergence is a complex phenomenon involving multiple ecological and genetic factors and is considered to involve three phases: virus encounter with the new host, virus adaptation to the new host, and changes in the epidemiological dynamics. We analyze here if this was the case in the recent emergence of Pepino Mosaic Virus (PepMV) in tomato crops worldwide. We characterized a new strain of PepMV infecting wild tomato populations in Peru. Comparison of this strain with PepMV isolates from tomato crops, plus phylogenetic reconstructions, supports a scenario in which PepMV would have spread to crops from wild tomato relatives, followed by adaptation to the new host and eventually leading to population isolation. Our data, which derive from the analysis of field isolates rather than from experimental evolution approaches, significantly contribute to understanding of plant virus emergence, which is necessary for its anticipation and prevention.

Dataset Information

Ratio of mutated versus wild-type coat protein sequences in Pepino mosaic virus determines the nature and severity of yellowing symptoms on tomato plants.

Publications

Ratio of mutated versus wild-type coat protein sequences in Pepino mosaic virus determines the nature and severity of yellowing symptoms on tomato plants.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets