Transcriptome analysis of tomato seedlings infected by Pepino Mosaic Virus
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA841643 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR19363176.fastq.gz | Fastqsanger.gz | |||
| SRR19363177.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 2 of 2 |
Similar Datasets
Project description:Pepino Mosaic Virus (PepMV) consists a major pathogenic threat in the greenhouses worldwide and has a devasting impact on tomato global production. PepMV belongs to the Potexvirus genus of the Flexiviridae family. PepMV has a viral RNA genome of approximately 6400 nucleotides long that contains five open reading frames (ORFs) and 4 major genotypes have been characterized. TomCr3, an indigenous virulent PepMV strain derived from the Chilean (CH2) genotype, was isolated in Crete, Greece and was used for the mechanical infection of Belladonna F1 hybrid tomato seedlings. Here, we present the results of a deep RNA-sequencing (RNA-seq) analysis performed to characterize the dynamic expression profile of tomato genes upon PepMV infection, including tomato transcription factors.
2022-05-24 | GSE203627 | GEO
Project description:We constructed two independent small RNA libraries from leaves of mock and Cucumber mosaic virus (CMV) infected tomatoes, respectively, and sequenced with a high-throughput Illumina Solexa system. Based on sequence analysis and hairpin structure prediction, a total of 50 known miRNAs (32 families) and 568 potentially candidate miRNAs (PC-miRNAs) were firstly identified in tomato, with 12 known miRNAs and 154 PC-miRNAs supported by both the 3p and 5p strands. Comparative analysis revealed 79 miRNAs (including 15 novel tomato miRNAs) and 40 PC-miRNAs were differentially expressed between the two libraries. Among these virus responsive miRNAs, expression patters of some novel tomato miRNAs and PC-miRNAs in mock and in CMV-Fny infected tomatoes were further validated by qRT-PCR. Moreover, we revealed 563 potential targets for 66 tomato miRNAs by the recently developed degradome sequencing approach, including 124 targets for 7 new tomato miRNAs and 97 targets for 24 PC-miRNAs. Target annotation for the newly identified miRNA and PC-miRNAs indicated that they were involved in multiple biological processes, including transcriptional regulation and virus resistance. Gene ontology analysis of these target transcripts demonstrated that stress response- and photosynthesis-related genes were most affected in CMV-Fny infected tomatoes.
2014-10-20 | GSE56974 | GEO
Project description:The aim of this study was to compare the tomato global transcriptional profiles in response to host attack by ToMV and Fol in order to identify genomic differences and similarities in incompatible interactions between a foliar and a vascular pathogen. In order to identify a set of genes of interest in tomato plants infected with F. oxysporum f. sp. lycopersici (Fol) and Tomato Mosaic Virus (ToMV) a transcriptional analysis was performed. Tomato genes differentially expressed upon inoculation with Fol and ToMV were identified at 2 days post-inoculation, using an un-inoculated sample as reference.
2015-11-12 | E-GEOD-52336 | biostudies-arrayexpress
Project description:We constructed two independent small RNA libraries from leaves of mock and Cucumber mosaic virus (CMV) infected tomatoes, respectively, and sequenced with a high-throughput Illumina Solexa system. Based on sequence analysis and hairpin structure prediction, a total of 50 known miRNAs (32 families) and 568 potentially candidate miRNAs (PC-miRNAs) were firstly identified in tomato, with 12 known miRNAs and 154 PC-miRNAs supported by both the 3p and 5p strands. Comparative analysis revealed 79 miRNAs (including 15 novel tomato miRNAs) and 40 PC-miRNAs were differentially expressed between the two libraries. Among these virus responsive miRNAs, expression patters of some novel tomato miRNAs and PC-miRNAs in mock and in CMV-Fny infected tomatoes were further validated by qRT-PCR. Moreover, we revealed 563 potential targets for 66 tomato miRNAs by the recently developed degradome sequencing approach, including 124 targets for 7 new tomato miRNAs and 97 targets for 24 PC-miRNAs. Target annotation for the newly identified miRNA and PC-miRNAs indicated that they were involved in multiple biological processes, including transcriptional regulation and virus resistance. Gene ontology analysis of these target transcripts demonstrated that stress response- and photosynthesis-related genes were most affected in CMV-Fny infected tomatoes. Examination of small RNAs and their targets in mock and CMV-Fny infected tomatoes.
2014-10-20 | E-GEOD-56974 | biostudies-arrayexpress
Project description:Gene expression analysis of chrysanthemum infected with three different viruses including Cucumber mosaic virus, Tomato spotted wilt virus, and Potato virus X have been performed using the chrysanthemum 135K microarray.
2015-01-01 | GSE55985 | GEO
Project description:Tomato mottle mosaic virus cultivar:tomato Raw sequence reads
| PRJNA689058 | ENA
Project description:Gene expression analysis of chrysanthemum infected with three different viruses including Cucumber mosaic virus, Tomato spotted wilt virus, and Potato virus X have been performed using the chrysanthemum 135K microarray. Mock and each virus infected chrysanthemum plants were subjected for microarray analysis.
2015-01-01 | E-GEOD-55985 | biostudies-arrayexpress
Project description:Sequencing of small RNAs from Arabidopsis leaves non-infected and infected with Turnip mosaic virus at 14 days post inoculation
2018-03-01 | GSE110940 | GEO
Project description:Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus at 6 days post inoculation.
2021-02-25 | GSE167415 | GEO
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress