Dataset Information

Cerebrospinal Fluid and Brain Tissue Penetration of Tenofovir, Lamivudine, and Efavirenz in Postmortem Tissues with Cryptococcal Meningitis.

ABSTRACT: The central nervous system (CNS) is a known HIV reservoir, yet little is known about drug exposure in the brain. Our primary objective was to quantify exposure of three common antiretrovirals in brain tissue and compare exposures to plasma and cerebrospinal fluid (CSF). We also sought to identify pockets of brain most vulnerable to inadequate drug exposures and examine the role of meningitis in drug penetration into the CNS. Tenofovir, lamivudine, and efavirenz concentrations were measured using liquid chromatography and tandem mass spectrometry in plasma and CSF from 14 individuals with HIV, 7 with cryptococcal meningitis. In four individuals (three with meningitis) drug concentrations were also measured in 13 distinct brain tissue regions. In subjects with meningitis, geometric mean ratio (95% confidence interval) of tenofovir CSF to plasma was 66% (7-598%) and 14% (6-31%) in subjects without meningitis. Lamivudine CSF penetration was 100% (25-409%) in subjects with meningitis and 30% (24-37%) in subjects without meningitis. Tenofovir brain tissue concentrations were 36% (14-124%) of plasma and 49% (1-572%) of CSF. Lamivudine brain concentrations were 37% (23-64%) of plasma and 27% (1-104%) of CSF. Efavirenz brain tissue concentrations were 128% (108-179%) of plasma. Tissues collected postmortem provide a unique opportunity to assess drug distribution in tissues difficult to sample in living subjects. CSF is a poor surrogate for drug exposure throughout the CNS. Antiretrovirals differentially penetrate into the CNS and penetration may be enhanced by meningitis.

SUBMITTER: Nicol MR

PROVIDER: S-EPMC6742940 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:BACKGROUND:(1?3)-?-d-Glucan (BDG) is a helpful diagnostic marker for many invasive fungal infections. However, BDG is not thought to be useful in diagnosing cryptococcosis. We evaluated the utility of BDG as an adjunct diagnostic tool for patients infected with human immunodeficiency virus (HIV) and presenting with suspected cryptococcal meningitis. METHODS:The Fungitell assay was used to measure BDG concentrations in cerebrospinal fluid (CSF) (n = 177) and serum (n = 109) of HIV-infected Ugandans and South Africans with suspected meningitis. Correlations between BDG concentrations and quantitative CSF cryptococcal cultures, CSF cryptococcal antigen (CRAG) titers, and 18 different CSF cytokine concentrations were assessed using non-parametric tests. Mixed models evaluated longitudinal changes in CSF BDG concentrations. Survival analyses were used to evaluate BDG's relationship with mortality. RESULTS:The Fungitell BDG assay provided 89% sensitivity and 85% specificity in CSF for cryptococcal meningitis. Serum sensitivity was suboptimal (79%). Cerebrospinal fluid BDG concentrations at diagnosis were median (interquartile range) 343 (200-597) pg/mL in cryptococcal patients and 37 (23-46) pg/mL in patients without cryptococcosis. Sensitivity in CSF improved to 98% (53 of 54) when initial fungal burdens were ?10 000 colony-forming units/mL. (1?3)-?-d-Glucan normalized rapidly after initiating antifungal therapy. Baseline BDG concentrations correlated with CSF fungal burden (rho = 0.820; P < .001), CSF CRAG lateral flow assay titers (rho = 0.780, P < .001), and monocyte chemotactic protein-1 levels in CSF (P = .047). In patients with cryptococcal meningitis, BDG ?500 pg/mL at diagnosis was associated with increased 10-week mortality. CONCLUSIONS:(1?3)-?-d-Glucan is detectable in the CSF of HIV-infected patients with Cryptococcus, and it may provide useful prognostic information. Sensitivity is less than CRAG; however, BDG normalizes rapidly, unlike CRAG, making BDG potentially useful in diagnosing recurrent episodes.

Project description:BackgroundCryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.MethodsThe CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.ResultsThe 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.ConclusionsThe metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Dataset Information

Cerebrospinal Fluid and Brain Tissue Penetration of Tenofovir, Lamivudine, and Efavirenz in Postmortem Tissues with Cryptococcal Meningitis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets