Browse
Submit Data
Databases
API
Help

Dataset Information

30 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Variants in DOCK3 cause developmental delay and hypotonia.

ABSTRACT: The DOCK3 gene encodes the Dedicator of cytokinesis 3 (DOCK3) protein, which belongs to the family of guanine nucleotide exchange factors and is expressed almost exclusively in the brain and spinal cord. We used whole exome sequencing (WES) to investigate the molecular cause of developmental delay and hypotonia in three unrelated probands. WES identified truncating and splice site variants in Patient 1 and compound heterozygous and homozygous missense variants in Patients 2 and 3, respectively. We studied the effect of the three missense variants in vitro by using site-directed mutagenesis and pull-down assay and show that the induction of Rac1 activation was significantly lower in DOCK3 mutant cells compared with wild type human DOCK3 (P?

SUBMITTER: Wiltrout K

PROVIDER: S-EPMC6777627 | biostudies-literature | 2019 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Variants in DOCK3 cause developmental delay and hypotonia.

Wiltrout Kimberly K Ferrer Alejandro A van de Laar Ingrid I Namekata Kazuhiko K Harada Takayuki T Klee Eric W EW Zimmerman Michael T MT Cousin Margot A MA Kempainen Jennifer L JL Babovic-Vuksanovic Dusica D van Slegtenhorst Marjon A MA Aarts-Tesselaar Coranne D CD Schnur Rhonda E RE Andrews Marisa M Shinawi Marwan M

European journal of human genetics : EJHG 20190411 8

The DOCK3 gene encodes the Dedicator of cytokinesis 3 (DOCK3) protein, which belongs to the family of guanine nucleotide exchange factors and is expressed almost exclusively in the brain and spinal cord. We used whole exome sequencing (WES) to investigate the molecular cause of developmental delay and hypotonia in three unrelated probands. WES identified truncating and splice site variants in Patient 1 and compound heterozygous and homozygous missense variants in Patients 2 and 3, respectively. ...[more]

PMID: 30976111

Similar Datasets

Variants in GNAI1 cause a syndrome associated with variable features including developmental delay, seizures, and hypotonia.

Project description:PurposeNeurodevelopmental disorders (NDDs) encompass a spectrum of genetically heterogeneous disorders with features that commonly include developmental delay, intellectual disability, and autism spectrum disorders. We sought to delineate the molecular and phenotypic spectrum of a novel neurodevelopmental disorder caused by variants in the GNAI1 gene.MethodsThrough large cohort trio-based exome sequencing and international data-sharing, we identified 24 unrelated individuals with NDD phenotypes and a variant in GNAI1, which encodes the inhibitory Gαi1 subunit of heterotrimeric G-proteins. We collected detailed genotype and phenotype information for each affected individual.ResultsWe identified 16 unique variants in GNAI1 in 24 affected individuals; 23 occurred de novo and 1 was inherited from a mosaic parent. Most affected individuals have a severe neurodevelopmental disorder. Core features include global developmental delay, intellectual disability, hypotonia, and epilepsy.ConclusionThis collaboration establishes GNAI1 variants as a cause of NDDs. GNAI1-related NDD is most often characterized by severe to profound delays, hypotonia, epilepsy that ranges from self-limiting to intractable, behavior problems, and variable mild dysmorphic features.

| S-EPMC8107131 | biostudies-literature

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

Project description:Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3.

| S-EPMC5701309 | biostudies-literature

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Project description:Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

| S-EPMC7308501 | biostudies-literature

Monoallelic and Biallelic Variants in EMC1 Identified in Individuals with Global Developmental Delay, Hypotonia, Scoliosis, and Cerebellar Atrophy.

Project description:The paradigm of a single gene associated with one specific phenotype and mode of inheritance has been repeatedly challenged. Genotype-phenotype correlations can often be traced to different mutation types, localization of the variants in distinct protein domains, or the trigger of or escape from nonsense-mediated decay. Using whole-exome sequencing, we identified homozygous variants in EMC1 that segregated with a phenotype of developmental delay, hypotonia, scoliosis, and cerebellar atrophy in three families. In addition, a de novo heterozygous EMC1 variant was seen in an individual with a similar clinical and MRI imaging phenotype. EMC1 encodes a member of the endoplasmic reticulum (ER)-membrane protein complex (EMC), an evolutionarily conserved complex that has been proposed to have multiple roles in ER-associated degradation, ER-mitochondria tethering, and proper assembly of multi-pass transmembrane proteins. Perturbations of protein folding and organelle crosstalk have been implicated in neurodegenerative processes including cerebellar atrophy. We propose EMC1 as a gene in which either biallelic or monoallelic variants might lead to a syndrome including intellectual disability and preferential degeneration of the cerebellum.

| S-EPMC4800043 | biostudies-literature

De novo variants in MPP5 cause global developmental delay and behavioral changes.

Project description:Membrane Protein Palmitoylated 5 (MPP5) is a highly conserved apical complex protein essential for cell polarity, fate and survival. Defects in cell polarity are associated with neurologic disorders including autism and microcephaly. MPP5 is essential for neurogenesis in animal models, but human variants leading to neurologic impairment have not been described. We identified three patients with heterozygous MPP5 de novo variants (DNV) and global developmental delay (GDD) and compared their phenotypes and magnetic resonance imaging (MRI) to ascertain how MPP5 DNV leads to GDD. All three patients with MPP5 DNV experienced GDD with language delay/regression and behavioral changes. MRI ranged from normal to decreased gyral folding and microcephaly. The effects of MPP5 depletion on the developing brain were assessed by creating a heterozygous conditional knock out (het CKO) murine model with central nervous system (CNS)-specific Nestin-Cre drivers. In the het CKO model, Mpp5 depletion led to microcephaly, decreased cerebellar volume and cortical thickness. Het CKO mice had decreased ependymal cells and Mpp5 at the apical surface of cortical ventricular zone compared with wild type. Het CKO mice also failed to maintain progenitor pools essential for neurogenesis. The proportion of cortical cells undergoing apoptotic cell death increased, suggesting that cell death reduces progenitor population and neuron number. Het CKO mice also showed behavioral changes, similar to our patients. To our knowledge, this is the first report to show that variants in MPP5 are associated with GDD, behavioral abnormalities and language regression/delay. Murine modeling shows that neurogenesis is likely altered in these individuals, with cell death and skewed cellular composition playing significant roles.

| S-EPMC7906781 | biostudies-literature

De novo mutations in PURA are associated with hypotonia and developmental delay.

Project description:PURA is the leading candidate gene responsible for the developmental phenotype in the 5q31.3 microdeletion syndrome. De novo mutations in PURA were recently reported in 15 individuals with developmental features similar to the 5q31.3 microdeletion syndrome. Here we describe six unrelated children who were identified by clinical whole-exome sequencing (WES) to have novel de novo variants in PURA with a similar phenotype of hypotonia and developmental delay and frequently associated with seizures. The protein Pur? (encoded by PURA) is involved in neuronal proliferation, dendrite maturation, and the transport of mRNA to translation sites during neuronal development. Mutations in PURA may alter normal brain development and impair neuronal function, leading to developmental delay and the seizures observed in patients with mutations in PURA.

| S-EPMC4850890 | biostudies-literature

De novo mutations in NALCN cause a syndrome characterized by congenital contractures of the limbs and face, hypotonia, and developmental delay.

Project description:Freeman-Sheldon syndrome, or distal arthrogryposis type 2A (DA2A), is an autosomal-dominant condition caused by mutations in MYH3 and characterized by multiple congenital contractures of the face and limbs and normal cognitive development. We identified a subset of five individuals who had been putatively diagnosed with "DA2A with severe neurological abnormalities" and for whom congenital contractures of the limbs and face, hypotonia, and global developmental delay had resulted in early death in three cases; this is a unique condition that we now refer to as CLIFAHDD syndrome. Exome sequencing identified missense mutations in the sodium leak channel, non-selective (NALCN) in four families affected by CLIFAHDD syndrome. We used molecular-inversion probes to screen for NALCN in a cohort of 202 distal arthrogryposis (DA)-affected individuals as well as concurrent exome sequencing of six other DA-affected individuals, thus revealing NALCN mutations in ten additional families with "atypical" forms of DA. All 14 mutations were missense variants predicted to alter amino acid residues in or near the S5 and S6 pore-forming segments of NALCN, highlighting the functional importance of these segments. In vitro functional studies demonstrated that NALCN alterations nearly abolished the expression of wild-type NALCN, suggesting that alterations that cause CLIFAHDD syndrome have a dominant-negative effect. In contrast, homozygosity for mutations in other regions of NALCN has been reported in three families affected by an autosomal-recessive condition characterized mainly by hypotonia and severe intellectual disability. Accordingly, mutations in NALCN can cause either a recessive or dominant condition characterized by varied though overlapping phenotypic features, perhaps based on the type of mutation and affected protein domain(s).

| S-EPMC4375444 | biostudies-literature

Bi-allelic Variants in IQSEC1 Cause Intellectual Disability, Developmental Delay, and Short Stature.

Project description:We report two consanguineous families with probands that exhibit intellectual disability, developmental delay, short stature, aphasia, and hypotonia in which homozygous non-synonymous variants were identified in IQSEC1 (GenBank: NM_001134382.3). In a Pakistani family, the IQSEC1 segregating variant is c.1028C>T (p.Thr343Met), while in a Saudi Arabian family the variant is c.962G>A (p.Arg321Gln). IQSEC1-3 encode guanine nucleotide exchange factors for the small GTPase ARF6 and their loss affects a variety of actin-dependent cellular processes, including AMPA receptor trafficking at synapses. The ortholog of IQSECs in the fly is schizo and its loss affects growth cone guidance at the midline in the CNS, also an actin-dependent process. Overexpression of the reference IQSEC1 cDNA in wild-type flies is lethal, but overexpression of the two variant IQSEC1 cDNAs did not affect viability. Loss of schizo caused embryonic lethality that could be rescued to 2nd instar larvae by moderate expression of the human reference cDNA. However, the p.Arg321Gln and p.Thr343Met variants failed to rescue embryonic lethality. These data indicate that the variants behave as loss-of-function mutations. We also show that schizo in photoreceptors is required for phototransduction. Finally, mice with a conditional Iqsec1 deletion in cortical neurons exhibited an increased density of dendritic spines with an immature morphology. The phenotypic similarity of the affecteds and the functional experiments in flies and mice indicate that IQSEC1 variants are the cause of a recessive disease with intellectual disability, developmental delay, and short stature, and that axonal guidance and dendritic projection defects as well as dendritic spine dysgenesis may underlie disease pathogenesis.

| S-EPMC6848997 | biostudies-literature

Diagnosis of Schaaf-Yang syndrome in Korean children with developmental delay and hypotonia.

Project description:AbstractSchaaf-Yang syndrome (SYS) is a recently identified disorder caused by a loss-of-function mutation in a maternally imprinted gene, MAGEL2, at 15q11.2q13. Due to its extreme rarity and wide range of clinical severity, clinical suspicion is difficult for a physician. In the current study, its frequency among the Korean pediatric patients with developmental delay (DD) or intellectual disability (ID) was assessed. As the first report of Korean patients with SYS, our study aims to increase the awareness of this condition among the physicians taking care of the pediatric patients with DD/ID and hypotonia.The patients diagnosed with SYS by whole-exome sequencing (WES) among the 460 Korean pediatric patients with DD/ID were included, and their clinical and molecular features were reviewed.Four patients (0.9%) were diagnosed with SYS. Profound DD (4 patients), multiple anomalies including joint contractures and facial dysmorphism (4 patients), generalized hypotonia (3 patients), and severe respiratory difficulty requiring mechanical ventilation (3 patients) were noted in most cases, similar to those in previous reports. Sleep apnea (2 patients), autistic features (2 patients), a high grade of gastroesophageal reflux (1 patient), and seizures (1 patient) were found as well. A total of 3 different truncating MAGEL2 mutations were identified. A previously-reported mutation, to be the most common one, c.1996dupC, was found in 2 patients. The other 2 mutations, c.2217delC and c.3449_3450delTT were novel mutations. As MAGEL2 is maternally imprinted, 2 patients had inherited the MAGEL2 mutation from their respective healthy fathers.SYS is an extremely rare cause of DD/ID. However, hypotonia, joint contractures, profound DD/ID and facial dysmorphism are the suggestive clinical features for SYS. As a maternally imprinted disorder, it should be reminded that SYS may be inherited in form of a mutation from a healthy father.

| S-EPMC7748310 | biostudies-literature

Variants of NAV3, a neuronal morphogenesis protein, cause intellectual disability, developmental delay, and microcephaly.

Project description:Microtubule associated proteins (MAPs) are widely expressed in the central nervous system, and have established roles in cell proliferation, myelination, neurite formation, axon specification, outgrowth, dendrite, and synapse formation. We report eleven individuals from seven families harboring predicted pathogenic biallelic, de novo, and heterozygous variants in the NAV3 gene, which encodes the microtubule positive tip protein neuron navigator 3 (NAV3). All affected individuals have intellectual disability (ID), microcephaly, skeletal deformities, ocular anomalies, and behavioral issues. In mouse brain, Nav3 is expressed throughout the nervous system, with more prominent signatures in postmitotic, excitatory, inhibiting, and sensory neurons. When overexpressed in HEK293T and COS7 cells, pathogenic variants impaired NAV3 ability to stabilize microtubules. Further, knocking-down nav3 in zebrafish led to severe morphological defects, microcephaly, impaired neuronal growth, and behavioral impairment, which were rescued with co-injection of WT NAV3 mRNA and not by transcripts encoding the pathogenic variants. Our findings establish the role of NAV3 in neurodevelopmental disorders, and reveal its involvement in neuronal morphogenesis, and neuromuscular responses.

| S-EPMC11231287 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data