Browse
Submit Data
Databases
API
Help

Dataset Information

26 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Variants in GNAI1 cause a syndrome associated with variable features including developmental delay, seizures, and hypotonia.

ABSTRACT:

Purpose

Neurodevelopmental disorders (NDDs) encompass a spectrum of genetically heterogeneous disorders with features that commonly include developmental delay, intellectual disability, and autism spectrum disorders. We sought to delineate the molecular and phenotypic spectrum of a novel neurodevelopmental disorder caused by variants in the GNAI1 gene.

Methods

Through large cohort trio-based exome sequencing and international data-sharing, we identified 24 unrelated individuals with NDD phenotypes and a variant in GNAI1, which encodes the inhibitory Gαi1 subunit of heterotrimeric G-proteins. We collected detailed genotype and phenotype information for each affected individual.

Results

We identified 16 unique variants in GNAI1 in 24 affected individuals; 23 occurred de novo and 1 was inherited from a mosaic parent. Most affected individuals have a severe neurodevelopmental disorder. Core features include global developmental delay, intellectual disability, hypotonia, and epilepsy.

Conclusion

This collaboration establishes GNAI1 variants as a cause of NDDs. GNAI1-related NDD is most often characterized by severe to profound delays, hypotonia, epilepsy that ranges from self-limiting to intractable, behavior problems, and variable mild dysmorphic features.

SUBMITTER: Muir AM

PROVIDER: S-EPMC8107131 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Variants in DOCK3 cause developmental delay and hypotonia.

Project description:The DOCK3 gene encodes the Dedicator of cytokinesis 3 (DOCK3) protein, which belongs to the family of guanine nucleotide exchange factors and is expressed almost exclusively in the brain and spinal cord. We used whole exome sequencing (WES) to investigate the molecular cause of developmental delay and hypotonia in three unrelated probands. WES identified truncating and splice site variants in Patient 1 and compound heterozygous and homozygous missense variants in Patients 2 and 3, respectively. We studied the effect of the three missense variants in vitro by using site-directed mutagenesis and pull-down assay and show that the induction of Rac1 activation was significantly lower in DOCK3 mutant cells compared with wild type human DOCK3 (P < 0.05). We generated a protein model to further examine the effect of the two missense variants within or adjacent to the DHR-2 domain in DOCK3 and this model supports pathogenicity. Our results support a loss of function mechanism but the data on the patients with missense variants should be cautiously interpreted because of the variability of the phenotypes and limited number of cases. Prior studies have described DOCK3 bi-allelic loss of function variants in two families with ataxia, hypotonia, and developmental delay. Here, we report on three patients with DOCK3-related developmental delay, wide-based or uncoordinated gait, and hypotonia, further supporting DOCK3's role in a neurodevelopmental syndrome and expanding the spectrum of phenotypic and genotypic variability.

| S-EPMC6777627 | biostudies-literature

Pathogenic Variants in PIGG Cause Intellectual Disability with Seizures and Hypotonia.

Project description:Glycosylphosphatidylinositol (GPI) is a glycolipid that anchors >150 various proteins to the cell surface. At least 27 genes are involved in biosynthesis and transport of GPI-anchored proteins (GPI-APs). To date, mutations in 13 of these genes are known to cause inherited GPI deficiencies (IGDs), and all are inherited as recessive traits. IGDs mainly manifest as intellectual disability, epilepsy, coarse facial features, and multiple organ anomalies. These symptoms are caused by the decreased surface expression of GPI-APs or by structural abnormalities of GPI. Here, we present five affected individuals (from two consanguineous families from Egypt and Pakistan and one non-consanguineous family from Japan) who show intellectual disability, hypotonia, and early-onset seizures. We identified pathogenic variants in PIGG, a gene in the GPI pathway. In the consanguineous families, homozygous variants c.928C>T (p.Gln310(∗)) and c.2261+1G>C were found, whereas the Japanese individual was compound heterozygous for c.2005C>T (p.Arg669Cys) and a 2.4 Mb deletion involving PIGG. PIGG is the enzyme that modifies the second mannose with ethanolamine phosphate, which is removed soon after GPI is attached to the protein. Physiological significance of this transient modification has been unclear. Using B lymphoblasts from affected individuals of the Egyptian and Japanese families, we revealed that PIGG activity was almost completely abolished; however, the GPI-APs had normal surface levels and normal structure, indicating that the pathogenesis of PIGG deficiency is not yet fully understood. The discovery of pathogenic variants in PIGG expands the spectrum of IGDs and further enhances our understanding of this etiopathogenic class of intellectual disability.

| S-EPMC4833197 | biostudies-literature

A de novo missense mutation in ZMYND11 is associated with global developmental delay, seizures, and hypotonia.

Project description:Recently, mutations in the zinc finger MYND-type containing 11 (ZMYND11) gene were identified in patients with autism spectrum disorders, intellectual disability, aggression, and complex neuropsychiatric features, supporting that this gene is implicated in 10p15.3 microdeletion syndrome. We report a novel de novo variant in the ZMYND11 gene (p.Ser421Asn) in a patient with a complex neurodevelopmental phenotype. The patient is a 24-yr-old Caucasian/Filipino female with seizures, global developmental delay, sensorineural hearing loss, hypotonia, dysmorphic features, and other features including a happy disposition and ataxic gait similar to Angelman syndrome. In addition, this patient had uncommon features including eosinophilic esophagitis and multiple, severe allergies not described in similar ZMYND11 cases. This new case further supports the association of ZMYND11 with autistic-like phenotypes and suggests that ZMYND11 should be included in the list of potentially causative candidate genes in cases with complex neurodevelopmental phenotypes.

| S-EPMC5002929 | biostudies-literature

De Novo Missense Variants in TRAF7 Cause Developmental Delay, Congenital Anomalies, and Dysmorphic Features.

Project description:TRAF7 is a multi-functional protein involved in diverse signaling pathways and cellular processes. The phenotypic consequence of germline TRAF7 variants remains unclear. Here we report missense variants in TRAF7 in seven unrelated individuals referred for clinical exome sequencing. The seven individuals share substantial phenotypic overlap, with developmental delay, congenital heart defects, limb and digital anomalies, and dysmorphic features emerging as key unifying features. The identified variants are de novo in six individuals and comprise four distinct missense changes, including a c.1964G>A (p.Arg655Gln) variant that is recurrent in four individuals. These variants affect evolutionarily conserved amino acids and are located in key functional domains. Gene-specific mutation rate analysis showed that the occurrence of the de novo variants in TRAF7 (p = 2.6 × 10-3) and the recurrent de novo c.1964G>A (p.Arg655Gln) variant (p = 1.9 × 10-8) in our exome cohort was unlikely to have occurred by chance. In vitro analyses of the observed TRAF7 mutations showed reduced ERK1/2 phosphorylation. Our findings suggest that missense mutations in TRAF7 are associated with a multisystem disorder and provide evidence of a role for TRAF7 in human development.

| S-EPMC6035372 | biostudies-literature

A recurrent, homozygous EMC10 frameshift variant is associated with a syndrome of developmental delay with variable seizures and dysmorphic features.

Project description:PurposeThe endoplasmic reticulum membrane complex (EMC) is a highly conserved, multifunctional 10-protein complex related to membrane protein biology. In seven families, we identified 13 individuals with highly overlapping phenotypes who harbor a single identical homozygous frameshift variant in EMC10.MethodsUsing exome, genome, and Sanger sequencing, a recurrent frameshift EMC10 variant was identified in affected individuals in an international cohort of consanguineous families. Multiple families were independently identified and connected via Matchmaker Exchange and internal databases. We assessed the effect of the frameshift variant on EMC10 RNA and protein expression and evaluated EMC10 expression in normal human brain tissue using immunohistochemistry.ResultsA homozygous variant EMC10 c.287delG (Refseq NM_206538.3, p.Gly96Alafs*9) segregated with affected individuals in each family, who exhibited a phenotypic spectrum of intellectual disability (ID) and global developmental delay (GDD), variable seizures and variable dysmorphic features (elongated face, curly hair, cubitus valgus, and arachnodactyly). The variant arose on two founder haplotypes and results in significantly reduced EMC10 RNA expression and an unstable truncated EMC10 protein.ConclusionWe propose that a homozygous loss-of-function variant in EMC10 causes a novel syndromic neurodevelopmental phenotype. Remarkably, the recurrent variant is likely the result of a hypermutable site and arose on distinct founder haplotypes.

| S-EPMC8187145 | biostudies-literature

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

Project description:Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3.

| S-EPMC5701309 | biostudies-literature

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Project description:Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

| S-EPMC7308501 | biostudies-literature

Bi-allelic CCDC47 Variants Cause a Disorder Characterized by Woolly Hair, Liver Dysfunction, Dysmorphic Features, and Global Developmental Delay.

Project description:Ca2+ signaling is vital for various cellular processes including synaptic vesicle exocytosis, muscle contraction, regulation of secretion, gene transcription, and cellular proliferation. The endoplasmic reticulum (ER) is the largest intracellular Ca2+ store, and dysregulation of ER Ca2+ signaling and homeostasis contributes to the pathogenesis of various complex disorders and Mendelian disease traits. We describe four unrelated individuals with a complex multisystem disorder characterized by woolly hair, liver dysfunction, pruritus, dysmorphic features, hypotonia, and global developmental delay. Through whole-exome sequencing and family-based genomics, we identified bi-allelic variants in CCDC47 that encodes the Ca2+-binding ER transmembrane protein CCDC47. CCDC47, also known as calumin, has been shown to bind Ca2+ with low affinity and high capacity. In mice, loss of Ccdc47 leads to embryonic lethality, suggesting that Ccdc47 is essential for early development. Characterization of cells from individuals with predicted likely damaging alleles showed decreased CCDC47 mRNA expression and protein levels. In vitro cellular experiments showed decreased total ER Ca2+ storage, impaired Ca2+ signaling mediated by the IP3R Ca2+ release channel, and reduced ER Ca2+ refilling via store-operated Ca2+ entry. These results, together with the previously described role of CCDC47 in Ca2+ signaling and development, suggest that bi-allelic loss-of-function variants in CCDC47 underlie the pathogenesis of this multisystem disorder.

| S-EPMC6218603 | biostudies-literature

Monoallelic and Biallelic Variants in EMC1 Identified in Individuals with Global Developmental Delay, Hypotonia, Scoliosis, and Cerebellar Atrophy.

Project description:The paradigm of a single gene associated with one specific phenotype and mode of inheritance has been repeatedly challenged. Genotype-phenotype correlations can often be traced to different mutation types, localization of the variants in distinct protein domains, or the trigger of or escape from nonsense-mediated decay. Using whole-exome sequencing, we identified homozygous variants in EMC1 that segregated with a phenotype of developmental delay, hypotonia, scoliosis, and cerebellar atrophy in three families. In addition, a de novo heterozygous EMC1 variant was seen in an individual with a similar clinical and MRI imaging phenotype. EMC1 encodes a member of the endoplasmic reticulum (ER)-membrane protein complex (EMC), an evolutionarily conserved complex that has been proposed to have multiple roles in ER-associated degradation, ER-mitochondria tethering, and proper assembly of multi-pass transmembrane proteins. Perturbations of protein folding and organelle crosstalk have been implicated in neurodegenerative processes including cerebellar atrophy. We propose EMC1 as a gene in which either biallelic or monoallelic variants might lead to a syndrome including intellectual disability and preferential degeneration of the cerebellum.

| S-EPMC4800043 | biostudies-literature

De novo variants in MPP5 cause global developmental delay and behavioral changes.

Project description:Membrane Protein Palmitoylated 5 (MPP5) is a highly conserved apical complex protein essential for cell polarity, fate and survival. Defects in cell polarity are associated with neurologic disorders including autism and microcephaly. MPP5 is essential for neurogenesis in animal models, but human variants leading to neurologic impairment have not been described. We identified three patients with heterozygous MPP5 de novo variants (DNV) and global developmental delay (GDD) and compared their phenotypes and magnetic resonance imaging (MRI) to ascertain how MPP5 DNV leads to GDD. All three patients with MPP5 DNV experienced GDD with language delay/regression and behavioral changes. MRI ranged from normal to decreased gyral folding and microcephaly. The effects of MPP5 depletion on the developing brain were assessed by creating a heterozygous conditional knock out (het CKO) murine model with central nervous system (CNS)-specific Nestin-Cre drivers. In the het CKO model, Mpp5 depletion led to microcephaly, decreased cerebellar volume and cortical thickness. Het CKO mice had decreased ependymal cells and Mpp5 at the apical surface of cortical ventricular zone compared with wild type. Het CKO mice also failed to maintain progenitor pools essential for neurogenesis. The proportion of cortical cells undergoing apoptotic cell death increased, suggesting that cell death reduces progenitor population and neuron number. Het CKO mice also showed behavioral changes, similar to our patients. To our knowledge, this is the first report to show that variants in MPP5 are associated with GDD, behavioral abnormalities and language regression/delay. Murine modeling shows that neurogenesis is likely altered in these individuals, with cell death and skewed cellular composition playing significant roles.

| S-EPMC7906781 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data