Dataset Information

Two novel mutations of PAX3 and SOX10 were characterized as genetic causes of Waardenburg Syndrome.

ABSTRACT: BACKGROUND:The objective of this study was to investigate the genetic causes of two probands diagnosed as Waardenburg syndrome (WS type I and IV) from two unrelated Chinese families. METHODS:PAX3 and SOX10 were the main pathogenic genes for WS type I (WS I) and IV (WS IV), respectively; all coding exons of these genes were sequenced on the two probands and their family members. Luciferase reporter assay and co-immunoprecipitation (CO-IP) were conducted to verify potential functional outcomes of the novel mutations. RESULTS:The first proband is a 9 years old girl diagnosed with WS I. A novel PAX3 heterozygous mutation of c.372-373delGA (p.N125fs) was identified, which results in a frameshift and truncation of PAX3 protein. In family II, a 2 years old girl was diagnosed with WS IV, and Sanger sequencing revealed a de novo SOX10 mutation of c.1114insTGGGGCCCCCACACTACACCGAC (p.Q372fs), a frameshift mutation that extends the amino acid chain of SOX10 protein. Functional studies indicated that the novel mutation of SOX10 had no effects on the interaction of SOX10 and PAX3, but reduced transactivate capacity of melanocyte inducing transcription factor (MITF) promoter. Both PAX3 and SOX10 mutation-induced defects of MITF transcription might contribute to the WS pathogenesis. CONCLUSION:We revealed a novel mutation in PAX3 and a de novo mutation in SOX10, which might account for the underlying pathogenesis of WS. This study expands the database of both PAX10 and PAX3 mutations and improves our understanding of the causes of WS.

SUBMITTER: Yu Y

PROVIDER: S-EPMC7216796 | biostudies-literature | 2020 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Two novel mutations of PAX3 and SOX10 were characterized as genetic causes of Waardenburg Syndrome.

Yu Yongbo Y Liu Wei W Chen Min M Yang Yang Y Yang Yeran Y Hong Enyu E Lu Jie J Zheng Jun J Ni Xin X Guo Yongli Y Zhang Jie J

Molecular genetics & genomic medicine 20200313 5

<h4>Background</h4>The objective of this study was to investigate the genetic causes of two probands diagnosed as Waardenburg syndrome (WS type I and IV) from two unrelated Chinese families.<h4>Methods</h4>PAX3 and SOX10 were the main pathogenic genes for WS type I (WS I) and IV (WS IV), respectively; all coding exons of these genes were sequenced on the two probands and their family members. Luciferase reporter assay and co-immunoprecipitation (CO-IP) were conducted to verify potential function ...[more]

PMID: 32168437

Similar Datasets

Project description:BackgroundWaardenburg syndrome (WS) is a rare genetic disorder. The purpose of this study was to investigate clinical and molecular characteristics of WS in four probands from four different Iranian families.Case presentationThe first patient was a 1-year-old symptomatic boy with congenital hearing loss and heterochromia iridis with a blue segment in his left iris. The second case was a 1.5-year-old symptomatic girl who manifested congenital profound hearing loss, brilliant blue eyes, and skin hypopigmentation on the abdominal region at birth time. The third patient was an 8-month-old symptomatic boy with developmental delay, mild atrophy, hypotonia, brilliant blue eyes, skin hypopigmentation on her hand and foot, Hirschsprung disease, and congenital profound hearing loss; the fourth patient was a 4-year-old symptomatic boy who showed dystopia canthorum, broad nasal root, synophrys, skin hypopigmentation on her hand and abdomen, brilliant blue eyes, and congenital profound hearing loss. Whole exome sequencing (WES) was used for each proband to identify the underlying genetic factor. Sanger sequencing was performed for validation of the identified mutations in probands and the available family members. A novel heterozygous frameshift mutation, c.996delT (p.K334Sfs*15), on exon 8 of the MITF gene was identified in the patient of the first family diagnosed with WS2A. Two novel de novo heterozygous mutations including a missense mutation, c.950G > A (p.R317K), on exon 8 of the MITF gene, and a frameshift mutation, c.684delC (p.E229Sfs*57), on the exon 3 of the SOX10 gene were detected in patients of the second and third families with WS2A and PCWH (Peripheral demyelinating neuropathy, Central dysmyelinating leukodystrophy, Waardenburg syndrome, Hirschsprung disease), respectively. A previously reported heterozygous frameshift mutation, c.1024_1040del AGCACGATTCCTTCCAA, (p.S342Pfs*62), on exon 7 of the PAX3 gene was identified in the patient of the fourth family with WS1.ConclusionsAn exact description of the mutations responsible for WS provides useful information to explain the molecular cause of clinical features of WS and contributes to better genetic counseling of WS patients and their families.

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30?), c.207_8 delCG (p.Cys71Hisfs?62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs?42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs?117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Dataset Information

Two novel mutations of PAX3 and SOX10 were characterized as genetic causes of Waardenburg Syndrome.

Publications

Two novel mutations of PAX3 and SOX10 were characterized as genetic causes of Waardenburg Syndrome.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets