Dataset Information

Spectrum of temporal bone abnormalities in patients with Waardenburg syndrome and SOX10 mutations.

ABSTRACT:

Background and purpose

Waardenburg syndrome, characterized by deafness and pigmentation abnormalities, is clinically and genetically heterogeneous, consisting of 4 distinct subtypes and involving several genes. SOX10 mutations have been found both in types 2 and 4 Waardenburg syndrome and neurologic variants. The purpose of this study was to evaluate both the full spectrum and relative frequencies of inner ear malformations in these patients.

Materials and methods

Fifteen patients with Waardenburg syndrome and different SOX10 mutations were studied retrospectively. Imaging was performed between February 2000 and March 2010 for cochlear implant work-up, diagnosis of hearing loss, and/or evaluation of neurologic impairment. Eleven patients had both CT and MR imaging examinations, 3 had MR imaging only, and 1 had CT only.

Results

Temporal bone abnormalities were bilateral. The most frequent pattern associated agenesis or hypoplasia of ≥1 semicircular canal, an enlarged vestibule, and a cochlea with a reduced size and occasionally an abnormal shape, but with normal partition in the 13/15 cases that could be analyzed. Three patients lacked a cochlear nerve, bilaterally in 2 patients. In addition, associated abnormalities were found when adequate MR imaging sequences were available: agenesis of the olfactory bulbs (7/8), hypoplastic or absent lacrimal glands (11/14), hypoplastic parotid glands (12/14), and white matter signal anomalies (7/13).

Conclusions

In the appropriate clinical context, bilateral agenesis or hypoplasia of the semicircular canals or both, associated with an enlarged vestibule and a cochlear deformity, strongly suggests a diagnosis of Waardenburg syndrome linked to a SOX10 mutation.

SUBMITTER: Elmaleh-Berges M

PROVIDER: S-EPMC7964579 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30?), c.207_8 delCG (p.Cys71Hisfs?62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs?42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs?117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Project description:BackgroundWaardenburg syndrome (WS) is a rare genetic disorder. The purpose of this study was to investigate clinical and molecular characteristics of WS in four probands from four different Iranian families.Case presentationThe first patient was a 1-year-old symptomatic boy with congenital hearing loss and heterochromia iridis with a blue segment in his left iris. The second case was a 1.5-year-old symptomatic girl who manifested congenital profound hearing loss, brilliant blue eyes, and skin hypopigmentation on the abdominal region at birth time. The third patient was an 8-month-old symptomatic boy with developmental delay, mild atrophy, hypotonia, brilliant blue eyes, skin hypopigmentation on her hand and foot, Hirschsprung disease, and congenital profound hearing loss; the fourth patient was a 4-year-old symptomatic boy who showed dystopia canthorum, broad nasal root, synophrys, skin hypopigmentation on her hand and abdomen, brilliant blue eyes, and congenital profound hearing loss. Whole exome sequencing (WES) was used for each proband to identify the underlying genetic factor. Sanger sequencing was performed for validation of the identified mutations in probands and the available family members. A novel heterozygous frameshift mutation, c.996delT (p.K334Sfs*15), on exon 8 of the MITF gene was identified in the patient of the first family diagnosed with WS2A. Two novel de novo heterozygous mutations including a missense mutation, c.950G > A (p.R317K), on exon 8 of the MITF gene, and a frameshift mutation, c.684delC (p.E229Sfs*57), on the exon 3 of the SOX10 gene were detected in patients of the second and third families with WS2A and PCWH (Peripheral demyelinating neuropathy, Central dysmyelinating leukodystrophy, Waardenburg syndrome, Hirschsprung disease), respectively. A previously reported heterozygous frameshift mutation, c.1024_1040del AGCACGATTCCTTCCAA, (p.S342Pfs*62), on exon 7 of the PAX3 gene was identified in the patient of the fourth family with WS1.ConclusionsAn exact description of the mutations responsible for WS provides useful information to explain the molecular cause of clinical features of WS and contributes to better genetic counseling of WS patients and their families.