Dataset Information

Neurological phenotype in Waardenburg syndrome type 4 correlates with novel SOX10 truncating mutations and expression in developing brain.

ABSTRACT: Waardenburg syndrome type 4 (WS4), also called Shah-Waardenburg syndrome, is a rare neurocristopathy that results from the absence of melanocytes and intrinsic ganglion cells of the terminal hindgut. WS4 is inherited as an autosomal recessive trait attributable to EDN3 or EDNRB mutations. It is inherited as an autosomal dominant condition when SOX10 mutations are involved. We report on three unrelated WS4 patients with growth retardation and an as-yet-unreported neurological phenotype with impairment of both the central and autonomous nervous systems and occasionally neonatal hypotonia and arthrogryposis. Each of the three patients was heterozygous for a SOX10 truncating mutation (Y313X in two patients and S251X [corrected] in one patient). The extended spectrum of the WS4 phenotype is relevant to the brain expression of SOX10 during human embryonic and fetal development. Indeed, the expression of SOX10 in human embryo was not restricted to neural-crest-derived cells but also involved fetal brain cells, most likely of glial origin. These data emphasize the important role of SOX10 in early development of both neural-crest-derived tissues, namely melanocytes, autonomic and enteric nervous systems, and glial cells of the central nervous system.

SUBMITTER: Touraine RL

PROVIDER: S-EPMC1378013 | biostudies-other | 2000 May

REPOSITORIES: biostudies-other

ACCESS DATA

Publications

Neurological phenotype in Waardenburg syndrome type 4 correlates with novel SOX10 truncating mutations and expression in developing brain.

Touraine R L RL Attié-Bitach T T Manceau E E Korsch E E Sarda P P Pingault V V Encha-Razavi F F Pelet A A Augé J J Nivelon-Chevallier A A Holschneider A M AM Munnes M M Doerfler W W Goossens M M Munnich A A Vekemans M M Lyonnet S S

American journal of human genetics 20000404 5

Waardenburg syndrome type 4 (WS4), also called Shah-Waardenburg syndrome, is a rare neurocristopathy that results from the absence of melanocytes and intrinsic ganglion cells of the terminal hindgut. WS4 is inherited as an autosomal recessive trait attributable to EDN3 or EDNRB mutations. It is inherited as an autosomal dominant condition when SOX10 mutations are involved. We report on three unrelated WS4 patients with growth retardation and an as-yet-unreported neurological phenotype with impai ...[more]

PMID: 10762540

Similar Datasets

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30?), c.207_8 delCG (p.Cys71Hisfs?62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs?42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs?117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Dataset Information

Neurological phenotype in Waardenburg syndrome type 4 correlates with novel SOX10 truncating mutations and expression in developing brain.

Publications

Neurological phenotype in Waardenburg syndrome type 4 correlates with novel SOX10 truncating mutations and expression in developing brain.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets