Browse
Submit Data
Databases
API
Help

Dataset Information

27 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SHLD2 promotes class switch recombination by preventing inactivating deletions within the Igh locus.

ABSTRACT: The newly identified shieldin complex, composed of SHLD1, SHLD2, SHLD3, and REV7, lies downstream of 53BP1 and acts to inhibit DNA resection and promote NHEJ. Here, we show that Shld2^-/- mice have defective class switch recombination (CSR) and that loss of SHLD2 can suppress the embryonic lethality of a Brca1^Δ11 mutation, highlighting its role as a key effector of 53BP1. Lymphocyte development and RAG1/2-mediated recombination were unaffected by SHLD2 deficiency. Interestingly, a significant fraction of Shld2^-/- primary B-cells and 53BP1- and shieldin-deficient CH12F3-2 B-cells permanently lose expression of immunoglobulin upon induction of CSR; this population of Ig-negative cells is also seen in other NHEJ-deficient cells and to a much lesser extent in WT cells. This loss of Ig is due to recombination coupled with overactive resection and loss of coding exons in the downstream acceptor constant region. Collectively, these data show that SHLD2 is the key effector of 53BP1 and critical for CSR in vivo by suppressing large deletions within the Igh locus.

SUBMITTER: Ling AK

PROVIDER: S-EPMC7403657 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

53BP1 Contributes to Igh Locus Chromatin Topology during Class Switch Recombination.

Project description:In B lymphocytes, Ig class switch recombination (CSR) is induced by activation-induced cytidine deaminase, which initiates a cascade of events leading to DNA double-strand break formation in switch (S) regions. Resolution of DNA double-strand breaks proceeds through formation of S-S synaptic complexes. S-S synapsis is mediated by a chromatin loop that spans the C region domain of the Igh locus. S-S junctions are joined via a nonhomologous end joining DNA repair process. CSR occurs via an intrachromosomal looping out and deletion mechanism that is 53BP1 dependent. However, the mechanism by which 53BP1 facilitates deletional CSR and inhibits inversional switching events remains unknown. We report a novel architectural role for 53BP1 in Igh chromatin looping in mouse B cells. Long-range interactions between the E? and 3'E? enhancers are significantly diminished in the absence of 53BP1. In contrast, germline transcript promoter:3'E? looping interactions are unaffected by 53BP1 deficiency. Furthermore, 53BP1 chromatin occupancy at sites in the Igh locus is B cell specific, is correlated with histone H4 lysine 20 marks, and is subject to chromatin spreading. Thus, 53BP1 is required for three-dimensional organization of the Igh locus and provides a plausible explanation for the link with 53BP1 enforcement of deletional CSR.

| S-EPMC5695034 | biostudies-literature

IgH 3' regulatory region increases ectopic class switch recombination.

Project description:DNA lesions inflicted by activation-induced deaminase (AID) instrumentally initiate the processes reshaping immunoglobulin genes in mature B-cells, from local somatic hypermutation (SHM) to junctions of distant breaks during class switch recombination (CSR). It remains incompletely understood how these divergent outcomes of AID attacks are differentially and temporally focused, with CSR strictly occurring in the Ig heavy chain (IgH) locus while SHM concentrates on rearranged V(D)J regions in the IgH and Ig light chain loci. In the IgH locus, disruption of either the 3'Regulatory Region (3'RR) super-enhancer or of switch (S) regions preceding constant genes, profoundly affects CSR. Reciprocally, we now examined if these elements are sufficient to induce CSR in a synthetic locus based on the Igκ locus backbone. Addition of a surrogate "core 3'RR" (c3'RR) and of a pair of transcribed and spliced Switch regions, together with a reporter system for "κ-CSR" yielded a switchable Igκ locus. While the c3'RR stimulated SHM at S regions, it also lowered the local SHM threshold necessary for switch recombination to occur. The 3'RR thus both helps recruit AID to initiate DNA lesions, but then also promotes their resolution through long-distance synapses and recombination following double-strand breaks.

| S-EPMC7869978 | biostudies-literature

Mediator facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin (Ig) class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation-induced cytidine deaminase (AID) to Ig switch regions (S regions). During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers, and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. In this study, we show that Med1 and Med12, two subunits of the mediator complex implicated in transcription initiation and long-range enhancer/promoter loop formation, are dynamically recruited to the IgH locus enhancers and the acceptor regions during CSR and that their knockdown in CH12 cells results in impaired CSR. Furthermore, we show that conditional inactivation of Med1 in B cells results in defective CSR and reduced acceptor S region transcription. Finally, we show that in B cells undergoing CSR, the dynamic long-range contacts between the IgH enhancers and the acceptor regions correlate with Med1 and Med12 binding and that they happen at a reduced frequency in Med1-deficient B cells. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which mediator facilitates the long-range contacts between S regions and the IgH locus enhancers during CSR and their transcriptional activation.

| S-EPMC4813673 | biostudies-literature

RNA 2'-O-methylation promotes persistent R-loop formation and AID-mediated IgH class switch recombination.

Project description:BackgroundRNA-DNA hybrids or R-loops are associated with deleterious genomic instability and protective immunoglobulin class switch recombination (CSR). However, the underlying phenomenon regulating the two contrasting functions of R-loops is unknown. Notably, the underlying mechanism that protects R-loops from classic RNase H-mediated digestion thereby promoting persistence of CSR-associated R-loops during CSR remains elusive.ResultsHere, we report that during CSR, R-loops formed at the immunoglobulin heavy (IgH) chain are modified by ribose 2'-O-methylation (2'-OMe). Moreover, we find that 2'-O-methyltransferase fibrillarin (FBL) interacts with activation-induced cytidine deaminase (AID) associated snoRNA aSNORD1C to facilitate the 2'-OMe. Moreover, deleting AID C-terminal tail impairs its association with aSNORD1C and FBL. Disrupting FBL, AID or aSNORD1C expression severely impairs 2'-OMe, R-loop stability and CSR. Surprisingly, FBL, AID's interaction partner and aSNORD1C promoted AID targeting to the IgH locus.ConclusionTaken together, our results suggest that 2'-OMe stabilizes IgH-associated R-loops to enable productive CSR. These results would shed light on AID-mediated CSR and explain the mechanism of R-loop-associated genomic instability.

| S-EPMC11232215 | biostudies-literature

Class-Switch Recombination in the Absence of the IgH 3' Regulatory Region.

Project description:The ∼28-kb 3' regulatory region (3'RR), which is located at the most distal 3' region of the Ig H chain locus, has multiple regulatory functions that control IgH expression, class-switch recombination (CSR), and somatic hypermutation. In this article, we report that deletion of the entire 3'RR in a mouse B cell line that is capable of robust cytokine-dependent CSR to IgA results in reduced, but not abolished, CSR. These data suggest that 3'RR is not absolutely required for CSR and, thus, is not essential for targeting activation-induced cytidine deaminase to S regions, as was suggested. Moreover, replacing 3'RR with a DNA fragment including only its four DNase I hypersensitive sites (lacking the large spacer regions) restores CSR to a level equivalent to or even higher than in wild-type cells, suggesting that the four hypersensitive sites contain most of the CSR-promoting functions of 3'RR. Stimulated cells express abundant germline transcripts, with the presence or absence of 3'RR, providing evidence that 3'RR has a role in promoting CSR that is unique from enhancing S region transcription.

| S-EPMC5026946 | biostudies-literature

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Internal IgH class switch region deletions are position-independent and enhanced by AID expression.

Project description:Ig heavy chain class switch recombination (CSR) involves a recombination/deletion mechanism that exchanges the expressed C(H) gene with a downstream C(H) gene. CSR is mediated by highly repetitive switch (S) region sequences and requires the activation-induced deaminase (AID). The S region 5' of the C mu gene (S mu) can undergo high-frequency internal deletions in normal B cells and B cell lines activated for CSR, although the relationship of these deletions and CSR has not been elucidated. In this study, we introduced constitutively transcribed S mu or S gamma 2b regions into a pro-B cell line that can be activated for AID expression, CSR, and endogenous S mu deletions. We find that randomly integrated S region transcription units in these cells also undergo increased levels of internal rearrangements after cellular activation, indicating that the deletion process is independent of location within the Ig heavy chain locus and potentially AID-promoted. To test the latter issue, we generated hybridomas from wild-type and AID-deficient activated B cells and assayed them for internal S mu deletions and S region mutations. These studies demonstrated that efficient intra-S region recombination depends on AID expression and that internal S region deletions are accompanied by frequent mutations, indicating that most S region deletions occur by the same mechanism as CSR.

| S-EPMC126611 | biostudies-literature

The repetitive portion of the Xenopus IgH Mu switch region mediates orientation-dependent class switch recombination.

Project description:Vertebrates developed immunoglobulin heavy chain (IgH) class switch recombination (CSR) to express different IgH constant regions. Most double-strand breaks for Ig CSR occur within the repetitive portion of the switch regions located upstream of each set of constant domain exons for the Igγ, Igα or Igϵ heavy chain. Unlike mammalian switch regions, Xenopus switch regions do not have a high G-density on the non-template DNA strand. In previous studies, when Xenopus Sμ DNA was moved to the genome of mice, it is able to support substantial CSR when it is used to replace the murine Sγ1 region. Here, we tested both the 2kb repetitive portion and the 4.6 kb full-length portions of the Xenopus Sμ in both their natural (forward) orientation relative to the constant domain exons, as well as the opposite (reverse) orientation. Consistent with previous work, we find that the 4.6 kb full-length Sμ mediates similar levels of CSR in both the forward and reverse orientations. Whereas, the forward orientation of the 2kb portion can restore the majority of the CSR level of the 4.6 kb full-length Sμ, the reverse orientation poorly supports R-looping and no CSR. The forward orientation of the 2kb repetitive portion has more GG dinucleotides on the non-template strand than the reverse orientation. The correlation of R-loop formation with CSR efficiency, as demonstrated in the 2kb repetitive fragment of the Xenopus switch region, confirms a role played by R-looping in CSR that appears to be conserved through evolution.

| S-EPMC4615597 | biostudies-literature

The Chromatin Reader ZMYND8 Regulates Igh Enhancers to Promote Immunoglobulin Class Switch Recombination.

Project description:Class switch recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3' Igh super-enhancer, 3' regulatory region (3'RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here, we identify the chromatin reader ZMYND8 as an essential regulator of the 3'RR. In B cells, ZMYND8 binds promoters and super-enhancers, including the Igh enhancers. ZMYND8 controls the 3'RR activity by modulating the enhancer transcriptional status. In its absence, there is increased 3'RR polymerase loading and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3'RR. Thus, ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3' Igh super-enhancer.

| S-EPMC6242708 | biostudies-literature

CCCTC-Binding Factor Locks Premature IgH Germline Transcription and Restrains Class Switch Recombination.

Project description:In response to antigenic stimulation B cells undergo class switch recombination (CSR) at the immunoglobulin heavy chain (IgH) to replace the primary IgM/IgD isotypes by IgG, IgE, or IgA. CSR is initiated by activation-induced cytidine deaminase (AID) through the deamination of cytosine residues at the switch (S) regions of IgH. B cell stimulation promotes germline transcription (GLT) of specific S regions, a necessary event prior to CSR because it facilitates AID access to S regions. Here, we show that CCCTC-binding factor (CTCF)-deficient mice are severely impaired in the generation of germinal center B cells and plasma cells after immunization in vivo, most likely due to impaired cell survival. Importantly, we find that CTCF-deficient B cells have an increased rate of CSR under various stimulation conditions in vitro. This effect is not secondary to altered cell proliferation or AID expression in CTCF-deficient cells. Instead, we find that CTCF-deficient B cells harbor an increased mutation frequency at switch regions, probably reflecting an increased accessibility of AID to IgH in the absence of CTCF. Moreover, CTCF deficiency triggers premature GLT of S regions in naïve B cells. Our results indicate that CTCF restricts CSR by enforcing GLT silencing and limiting AID access to IgH.

| S-EPMC5591319 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data