Browse
Submit Data
Databases
API
Help

Dataset Information

26 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Full-length genome sequence of segmented RNA virus from ticks was obtained using small RNA sequencing data.

ABSTRACT:

Background

In 2014, a novel tick-borne virus of the Flaviviridae family was first reported in the Mogiana region of Brazil and named the Mogiana tick virus (MGTV). Thereafter, the Jingmen tick virus (JMTV), Kindia tick virus (KITV), and Guangxi tick virus (GXTV)-evolutionarily related to MGTV-were reported.

Results

In the present study, we used small RNA sequencing (sRNA-seq) to detect viruses in ticks and discovered a new MGTV strain in Amblyomma testudinarium ticks collected in China's Yunnan Province in 2016. We obtained the full-length genome sequence of this MGTV strain Yunnan2016 (GenBank: MT080097, MT080098, MT080099 and MT080100) and recommended it for its inclusion in the NCBI RefSeq database for future studies on MGTV, JMTV, KITV and GXTV. Phylogenetic analysis showed that MGTV, JMTV, KITV and GXTV are monophyletic and belong to a MGTV group. Furthermore, this MGTV group of viruses may be phylogenetically related to geographical regions that were formerly part of the supercontinents Gondwana and Laurasia.

Conclusions

To the best of our knowledge, this is the first study in which 5' and 3' sRNAs were used to generate full-length genome sequences of, but not limited to, RNA viruses. We also demonstrated the feasibility of using the sRNA-seq based method for the detection of viruses in pooled two and even possible one small ticks. MGTV may preserve the characteristic of ancient RNA viruses, which can be used to study the origin and evolution of RNA viruses. In addition, MGTV can be used as novel species for studies in phylogeography.

SUBMITTER: Xu X

PROVIDER: S-EPMC7493057 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Baiting out a full length sequence from unmapped RNA-seq data.

Project description:BackgroundAs a powerful tool, RNA-Seq has been widely used in various studies. Usually, unmapped RNA-seq reads have been considered as useless and been trashed or ignored.ResultsWe develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data and randomly select one 149 bp read as a model. Specific reverse transcription primers are designed to amplify its both ends, followed by next generation sequencing. Then we design a statistical model based on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1556 bp, with insertion mutations in microsatellite structure.ConclusionWe believe this method would be a useful strategy to extract the sequences information from the unmapped RNA-seq data. Further, it is an alternative way to get the full length sequence of unknown cDNA.

| S-EPMC8626966 | biostudies-literature

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

Project description:High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

| S-EPMC2896179 | biostudies-literature

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

Project description:Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

| S-EPMC3287988 | biostudies-literature

Protocol for nearly full-length sequencing of HIV-1 RNA from plasma.

Project description:Nearly full-length genome sequencing of HIV-1 using peripheral blood mononuclear cells (PBMC) DNA as a template for PCR is now a relatively routine laboratory procedure. However, this has not been the case when using virion RNA as the template and this has made full genome analysis of circulating viruses difficult. Therefore, a well-developed procedure for sequencing of full-length HIV-1 RNA directly from plasma was needed. Plasma from U.S. donors representing a range of viral loads (VL) was used to develop the assay. RNA was extracted from plasma and reverse-transcribed. Two or three overlapping regions were PCR amplified to cover the entire viral genome and sequenced for verification. The success of the procedure was sensitive to VL but was routinely successful for VL greater than 10(5) and the rate declined in proportion to the VL. While the two-amplicon strategy had an advantage of increasing the possibility of amplifying a single species of HIV-1, the three-amplicon strategy was more successful in amplifying samples with low viral loads. This protocol provides a useful tool for molecular analysis to understand the HIV epidemic and pathogenesis, as well as diagnosis, therapy and future vaccine strategies.

| S-EPMC2170516 | biostudies-literature

Full-Length RNA Sequencing Provides Insights into Goldfish Evolution under Artificial Selection.

Project description:Goldfish Carassius auratus is an ideal model for exploring fish morphology evolution. Although genes underlying several ornamental traits have been identified, little is known about the effects of artificial selection on embryo gene expression. In the present study, hybrid transcriptome sequencing was conducted to reveal gene expression profiles of Celestial-Eye (CE) and Ryukin (RK) goldfish embryos. Full-length transcriptome sequencing on the PacBio platform identified 54,218 and 54,106 transcript isoforms in CE and RK goldfish, respectively. Of particular note was that thousands of alternative splicing (AS) and alternative polyadenylation (APA) events were identified in both goldfish breeds, and most of them were inter-breed specific. RT-PCR and Sanger sequencing showed that most of the predicted AS and APA were correct. Moreover, abundant long non-coding RNA and fusion genes were detected, and again most of them were inter-breed specific. Through RNA-seq, we detected thousands of differentially expressed genes (DEGs) in each embryonic stage between the two goldfish breeds. KEGG enrichment analysis on DEGs showed extensive differences between CE and RK goldfish in gene expression. Taken together, our results demonstrated that artificial selection has led to far-reaching influences on goldfish gene expression, which probably laid the genetic basis for hundreds of goldfish variations.

| S-EPMC9916754 | biostudies-literature

High resolution profiling of coral-associated bacterial communities using full-length 16S rRNA sequence data from PacBio SMRT sequencing system.

Project description:Coral reefs are a complex ecosystem consisting of coral animals and a vast array of associated symbionts including the dinoflagellate Symbiodinium, fungi, viruses and bacteria. Several studies have highlighted the importance of coral-associated bacteria and their fundamental roles in fitness and survival of the host animal. The scleractinian coral Porites lutea is one of the dominant reef-builders in the Indo-West Pacific. Currently, very little is known about the composition and structure of bacterial communities across P. lutea reefs. The purpose of this study is twofold: to demonstrate the advantages of using PacBio circular consensus sequencing technology in microbial community studies and to investigate the diversity and structure of P. lutea-associated microbiome in the Indo-Pacific. This is the first metagenomic study of marine environmental samples that utilises the PacBio sequencing system to capture full-length 16S rRNA sequences. We observed geographically distinct coral-associated microbial profiles between samples from the Gulf of Thailand and Andaman Sea. Despite the geographical and environmental impacts on the coral-host interactions, we identified a conserved community of bacteria that were present consistently across diverse reef habitats. Finally, we demonstrated the superior performance of full-length 16S rRNA sequences in resolving taxonomic uncertainty of coral associates at the species level.

| S-EPMC5459821 | biostudies-literature

The full-length transcriptome of <i>C. elegans</i> using direct RNA sequencing.

Project description:Current transcriptome annotations have largely relied on short read lengths intrinsic to the most widely used high-throughput cDNA sequencing technologies. For example, in the annotation of the Caenorhabditis elegans transcriptome, more than half of the transcript isoforms lack full-length support and instead rely on inference from short reads that do not span the full length of the isoform. We applied nanopore-based direct RNA sequencing to characterize the developmental polyadenylated transcriptome of C. elegans Taking advantage of long reads spanning the full length of mRNA transcripts, we provide support for 23,865 splice isoforms across 14,611 genes, without the need for computational reconstruction of gene models. Of the isoforms identified, 3452 are novel splice isoforms not present in the WormBase WS265 annotation. Furthermore, we identified 16,342 isoforms in the 3' untranslated region (3' UTR), 2640 of which are novel and do not fall within 10 bp of existing 3'-UTR data sets and annotations. Combining 3' UTRs and splice isoforms, we identified 28,858 full-length transcript isoforms. We also determined that poly(A) tail lengths of transcripts vary across development, as do the strengths of previously reported correlations between poly(A) tail length and expression level, and poly(A) tail length and 3'-UTR length. Finally, we have formatted this data as a publicly accessible track hub, enabling researchers to explore this data set easily in a genome browser.

| S-EPMC7050520 | biostudies-literature

Generation of full-length circular RNA libraries for Oxford Nanopore long-read sequencing.

Project description:Circular RNA (circRNA) is a noncoding RNA class with important implications for gene expression regulation, mostly by interaction with other RNA species or RNA-binding proteins. While the commonly applied short-read Illumina RNA-sequencing techniques can be used to detect circRNAs, their full sequence is not revealed. However, the complete sequence information is needed to analyze potential interactions and thus the mechanism of action of circRNAs. Here, we present an improved protocol to enrich and sequence full-length circRNAs by using the Oxford Nanopore long-read sequencing platform. The protocol involves an enrichment of lowly abundant circRNAs by exonuclease treatment and negative selection of linear RNAs. Then, a cDNA library is created and amplified by PCR. This protocol provides enough material for several sequencing runs. The library is used as input for ligation-based sequencing together with native barcoding. Stringent quality control of the libraries is ensured by a combination of Qubit, Fragment Analyzer and qRT-PCR. Multiplexing of up to 4 libraries yields in total more than 1-2 Million reads per library, of which 1-2% are circRNA-specific reads with >99% of them full-length. The protocol works well with human cancer cell lines. We further provide suggestions for the bioinformatic analysis of the created data, as well as the limitations of our approach together with recommendations for troubleshooting and interpretation. Taken together, this protocol enables reliable full-length analysis of circRNAs, a noncoding RNA type involved in a growing number of physiologic and pathologic conditions. Metadata Associated content. https://dx.doi.org/10.17504/protocols.io.rm7vzy8r4lx1/v2.

| S-EPMC9451095 | biostudies-literature

Fast and highly sensitive full-length single-cell RNA sequencing using FLASH-seq.

Project description:We present FLASH-seq (FS), a full-length single-cell RNA sequencing (scRNA-seq) method with increased sensitivity and reduced hands-on time compared to Smart-seq3. The entire FS protocol can be performed in ~4.5 hours, is simple to automate and can be easily miniaturized to decrease resource consumption. The FS protocol can also use unique molecular identifiers (UMIs) for molecule counting while displaying reduced strand-invasion artifacts. FS will be especially useful for characterizing gene expression at high resolution across multiple samples.

| S-EPMC9546769 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data