Browse
Submit Data
Databases
API
Help

Dataset Information

15 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

CRISPR-Mediated Isogenic Cell-SELEX Approach for Generating Highly Specific Aptamers Against Native Membrane Proteins.

ABSTRACT:

Introduction

The generation of affinity reagents that bind native membrane proteins with high specificity remains challenging. Most in vitro selection paradigms utilize different cell types for positive and negative rounds of selection (where the positive selection is against a cell that expresses the desired membrane protein and the negative selection is against a cell that lacks the protein). However, this strategy can yield affinity reagents that bind unintended membrane proteins on the target cells. To address this issue, we developed a systematic evolution of ligands by exponential enrichment (SELEX) scheme that utilizes isogenic pairs of cells generated via CRISPR techniques.

Methods

Using a Caco-2 epithelial cell line with constitutive Cas9 expression, we knocked out the SLC2A1 gene (encoding the GLUT1 glucose transporter) via lipofection with synthetic gRNAs. Cell-SELEX rounds were carried out against wild-type and GLUT1-null cells using a single-strand DNA (ssDNA) library. Next-generation sequencing (NGS) was used to quantify enrichment of prospective binders to the wild-type cells.

Results

10 rounds of cell-SELEX were conducted via simultaneous exposure of ssDNA pools to wild-type and GLUT1-null Caco-2 cells under continuous perfusion. The top binders identified from NGS were validated by flow cytometry and immunostaining for their specificity to the GLUT1 receptor.

Conclusions

Our data indicate that highly specific aptamers can be isolated with a SELEX strategy that utilizes isogenic cell lines. This approach may be broadly useful for generating affinity reagents that selectively bind to membrane proteins in their native conformations on the cell surface.

SUBMITTER: Rosch JC

PROVIDER: S-EPMC7596163 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

Novel Approach to Overcome Defects of Cell-SELEX in Developing Aptamers against Aspartate β-Hydroxylase.

Project description:Cell-based aptamer selection (Cell-SELEX) against predefined protein targets that benefits using the native form of the targets is the most promising approach to achieve aptamer probes capable of recognizing targets under both in vitro and in vivo conditions. The major disadvantages in Cell-SELEX are the imperfectness of the negative selection step and the lengthy procedure of selection. Here, we introduced the Counter-SELEX as part of our modified Cell-SELEX and implemented deep sequencing to overcome these shortcomings in developing aptamers against aspartate β-hydroxylase (ASPH) as a known tumor marker. In parallel with the conventional Cell-SELEX, five consecutive cycles of counter selection were accomplished using sequences bound to negative cells (the Counter-SELEX) to detect oligos that are not specific for ASPH. After high-throughput sequencing, the representative of each promising achieved family was subjected to further confirmatory analysis via flow cytometry, followed by the fluorescence immunostaining of histopathological sections. Implementing our innovative complementary method, annoying mis-selected sequences in Cell-SELEX enriched pools were effectively identified and removed. According to the affinity assay on the cells displaying ASPH, three aptamers, AP-Cell 1, AP-Cell 2, and AP-Cell 3, with K d values of 47.51, 39.38, and 65.23 nM, respectively, were obtained, while AP-Cell 1 and 3 could then successfully spot ASPH displayed on the tissues. Our study showed that the Counter-SELEX could be considered as a complementary method for Cell-SELEX to overcome the imperfectness of the negative selection step. Moreover, high-throughput nucleotide sequencing could help to shorten the overall process.

| S-EPMC8153902 | biostudies-literature

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

RAPID-SELEX for RNA aptamers.

Project description:Aptamers are high-affinity ligands selected from DNA or RNA libraries via SELEX, a repetitive in vitro process of sequential selection and amplification steps. RNA SELEX is more complicated than DNA SELEX because of the additional transcription and reverse transcription steps. Here, we report a new selection scheme, RAPID-SELEX (RNA Aptamer Isolation via Dual-cycles SELEX), that simplifies this process by systematically skipping unnecessary amplification steps. Using affinity microcolumns, we were able to complete a multiplex selection for protein targets, CHK2 and UBLCP1, in a third of the time required for analogous selections using a conventional SELEX approach. High-throughput sequencing of the enriched pools from both RAPID and SELEX revealed many identical candidate aptamers from the starting pool of 5 × 10(15) sequences. For CHK2, the same sequence was preferentially enriched in both selections as the top candidate and was found to bind to its respective target. These results demonstrate the efficiency and, most importantly, the robustness of our selection scheme. RAPID provides a generalized approach that can be used with any selection technology to accelerate the rate of aptamer discovery, without compromising selection performance.

| S-EPMC3869713 | biostudies-literature

Evolution of Complex Target SELEX to Identify Aptamers against Mammalian Cell-Surface Antigens.

Project description:The demand has increased for sophisticated molecular tools with improved detection limits. Such molecules should be simple in structure, yet stable enough for clinical applications. Nucleic acid aptamers (NAAs) represent a class of molecules able to meet this demand. In particular, aptamers, a class of small nucleic acid ligands that are composed of single-stranded modified/unmodified RNA/DNA molecules, can be evolved from a complex library using Systematic Evolution of Ligands by EXponential enrichment (SELEX) against almost any molecule. Since its introduction in 1990, in stages, SELEX technology has itself undergone several modifications, improving selection and broadening the repertoire of targets. This review summarizes these milestones that have pushed the field forward, allowing researchers to generate aptamers that can potentially be applied as therapeutic and diagnostic agents.

| S-EPMC5572134 | biostudies-other

Whole cell-SELEX aptamers for highly specific fluorescence molecular imaging of carcinomas in vivo.

Project description:BACKGROUND: Carcinomas make up the majority of cancers. Their accurate and specific diagnoses are of great significance for the improvement of patients' curability. METHODOLOGY/PRINCIPAL FINDINGS: In this paper, we report an effectual example of the in vivo fluorescence molecular imaging of carcinomas with extremely high specificity based on whole cell-SELEX aptamers. Firstly, S6, an aptamer against A549 lung carcinoma cells, was adopted and labeled with Cy5 to serve as a molecular imaging probe. Flow cytometry assays revealed that Cy5-S6 could not only specifically label in vitro cultured A549 cells in buffer, but also successfully achieve the detection of ex vivo cultured target cells in serum. When applied to in vivo imaging, Cy5-S6 was demonstrated to possess high specificity in identifying A549 carcinoma through a systematic comparison investigation. Particularly, after Cy5-S6 was intravenously injected into nude mice which were simultaneously grafted with A549 lung carcinoma and Tca8113 tongue carcinoma, a much longer retention time of Cy5-S6 in A549 tumor was observed and a clear targeted cancer imaging result was presented. On this basis, to further promote the application to imaging other carcinomas, LS2 and ZY8, which are two aptamers selected by our group against Bel-7404 and SMMC-7721 liver carcinoma cells respectively, were tested in a similar way, both in vitro and in vivo. Results showed that these aptamers were even effective in differentiating liver carcinomas of different subtypes in the same body. CONCLUSIONS/SIGNIFICANCE: This work might greatly advance the application of whole cell-SELEX aptamers to carcinomas-related in vivo researches.

| S-EPMC3741280 | biostudies-other

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

One-Pot SELEX: Identification of Specific Aptamers against Diverse Steroid Targets in One Selection.

Project description:Aptamers are well-established biorecognition molecules used in a wide variety of applications for the detection of their respective targets. However, individual SELEX processes typically performed for the identification of aptamers for each target can be quite time-consuming, labor-intensive, and costly. An alternative strategy is proposed herein for the simultaneous identification of different aptamers binding distinct but structurally similar targets in one single selection. This one-pot SELEX approach, using the steroids estradiol, progesterone, and testosterone as model targets, was achieved by combining the benefits of counter-SELEX with the power of next-generation sequencing and bioinformatics analysis. The pools from the last stage of the selection were compared in order to discover sequences with preferential abundance in only one of the pools. This led to the identification of aptamer candidates with potential specificity to a single steroid target. Binding studies demonstrated the high affinity of each selected aptamer for its respective target, and low nanomolar range dissociation constants calculated were similar to those previously reported for steroid-binding aptamers selected using traditional SELEX approaches. Finally, the selected aptamers were exploited in microtiter plate assays, achieving nanomolar limits of detection, while the specificity of these aptamers was also demonstrated. Overall, the one-pot SELEX strategy led to the discovery of aptamers for three different steroid targets in one single selection without compromising their affinity or specificity, demonstrating the power of this approach of aptamer discovery for the simultaneous selection of aptamers against multiple targets.

| S-EPMC6893951 | biostudies-literature

Discovering aptamers by cell-SELEX against human soluble growth factors ectopically expressed on yeast cell surface.

Project description:SELEX, the process of selecting aptamers, is often hampered by the difficulty of preparing target molecules in their native forms and by a lack of a simple yet quantitative assay for monitoring enrichment and affinity of reactive aptamers. In this study, we sought to discover DNA aptamers against human serum markers for potential therapeutic and diagnostic applications. To circumvent soluble expression and immobilization for performing SELEX, we ectopically expressed soluble growth factors on the surface of yeast cells to enable cell-SELEX and devised a flow cytometry-based method to quantitatively monitor progressive enrichment of specific aptamers. High-throughput sequencing of selected pools revealed that the emergence of highly enriched sequences concurred with the increase in the percentage of reactive aptamers shown by flow cytometry. Particularly, selected DNA aptamers against VEGF were specific and of high affinity (K(D) = ∼ 1 nM) and demonstrated a potent inhibition of capillary tube formation of endothelial cells, comparable to the effect of a clinically approved anti-VEGF antibody drug, bevacizumab. Considering the fact that many mammalian secretory proteins have been functionally expressed in yeast, the strategy of implementing cell-SELEX and quantitative binding assay can be extended to discover aptamers against a broad array of soluble antigens.

| S-EPMC3968096 | biostudies-literature