Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Natural RNA polymerase aptamers regulate transcription in E. coli [SELEX]

ABSTRACT: In search for RNA signals that modulate transcription via direct interaction with RNA polymerase (RNAP) we deep-sequenced an E. coli genomic library enriched for RNAP-binding RNAs. Many natural RNAP-binding aptamers, termed RAPs, were mapped to the genome. Over 60% of E. coli genes carry RAPs in their mRNA. Combining in vitro and in vivo approaches we characterized a subset of RAPs (iRAPs) that promote Rho-dependent transcription termination. A representative iRAP within the coding region of the essential gene, nadD, greatly reduces its transcriptional output in stationary phase and under oxidative stress, demonstrating that iRAPs control gene expression in response to changing growth conditions. The mechanism of iRAPs involves active uncoupling of transcription and translation, making the nascent RNA accessible to Rho. iRAPs encoded in the antisense strand also promote gene expression by reducing transcriptional interference. In essence, our work uncovers a broad class of cis-acting RNA signals that globally control bacterial transcription.

ORGANISM(S): Escherichia coli

PROVIDER: GSE98659 | GEO | 2017/06/01

SECONDARY ACCESSION(S): PRJNA385825

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Natural RNA polymerase aptamers regulate transcription in E. coli [3' RACE]

Project description:In search for RNA signals that modulate transcription via direct interaction with RNA polymerase (RNAP) we deep-sequenced an E. coli genomic library enriched for RNAP-binding RNAs. Many natural RNAP-binding aptamers, termed RAPs, were mapped to the genome. Over 60% of E. coli genes carry RAPs in their mRNA. Combining in vitro and in vivo approaches we characterized a subset of RAPs (iRAPs) that promote Rho-dependent transcription termination. A representative iRAP within the coding region of the essential gene, nadD, greatly reduces its transcriptional output in stationary phase and under oxidative stress, demonstrating that iRAPs control gene expression in response to changing growth conditions. The mechanism of iRAPs involves active uncoupling of transcription and translation, making the nascent RNA accessible to Rho. iRAPs encoded in the antisense strand also promote gene expression by reducing transcriptional interference. In essence, our work uncovers a broad class of cis-acting RNA signals that globally control bacterial transcription.

2017-06-01 | GSE98660 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Blocker-SELEX: A Structure-Guided Strategy for Developing Inhibitory Aptamers Disrupting Transcription Factor Interactions

Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.

2024-02-01 | GSE254651 | GEO

Rho directs widespread termination of intragenic and stable RNA transcription

Project description:The transcription termination factor Rho is a global regulator of RNA polymerase (RNAP). Although individual Rho-dependent terminators have been studied extensively, less is known about the sites of RNAP regulation by Rho on a genome-wide scale. Using chromatin immunoprecipitation and microarrays (ChIP-chip), we examined changes in the distribution of Escherichia coli RNAP in response to the Rho-specific inhibitor bicyclomycin (BCM). We found ~200 Rho-terminated loci that were divided evenly into two classes: intergenic (at the ends of genes) and intragenic (within genes). The intergenic class contained noncoding RNAs such as small RNAs (sRNAs) and transfer RNAs (tRNAs), establishing a previously unappreciated role of Rho in termination of stable RNA synthesis. The intragenic class of terminators included a novel set of short antisense transcripts, as judged by a shift in the distribution of RNAP in BCM-treated cells that was opposite to the direction of the corresponding gene. These Rho-terminated antisense transcripts point to a novel role of noncoding transcription in E. coli gene regulation that may resemble the ubiquitous noncoding transcription recently found to play myriad roles in eukaryotic gene regulation.

2009-06-23 | GSE16562 | GEO

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

Regulator trafficking on bacterial transcription units in vivo

Project description:The in vivo trafficking patterns on DNA by the bacterial regulators of transcript elongation Sigma70, Rho, NusA, and NusG and the explanation for high promoter-proximal levels or peaks of RNA polymerase (RNAP) are unknown. Genome-wide ChIP-chip on E. coli revealed distinct association patterns of regulators as RNAP transcribes away from promoters (Rho first, then NusA, and then NusG). However, the interactions of elongating complexes with these regulators, including a weak interaction with Sigma70, did not differ significantly among most transcription units. A modest variation of NusG signal among genes reflected increased NusG interaction as transcription progresses, rather than functional specialization of elongating complexes. Promoter-proximal RNAP peaks were offset from Sigma70 peaks in the direction of transcription and co-occurred with NusA and Rho peaks, suggesting that the RNAP peaks reflected elongating, rather than initiating, complexes. However, inhibition of Rho did not increase RNAP levels within genes downstream of the RNAP peaks, suggesting the peaks are caused by a mechanism other than simple Rho-dependent attenuation. Chromatin immunoprecipitation (ChIP) experiments were performed using antibodies against RNA polymerase (Beta' subunit), Sigma70, NusA, NusG, or Rho. Differentially labeled ChIP DNA and genomic DNA were competitively hybridized to an E. coli K-12 MG1655 tiling array with overlapping probes at ~24bp spacing across the entire genome. The series contains 17 total datasets.

2010-05-14 | E-GEOD-13938 | biostudies-arrayexpress

Rho directs widespread termination of intragenic and stable RNA transcription

2010-05-18 | E-GEOD-16562 | biostudies-arrayexpress

Regulator trafficking on bacterial transcription units in vivo

2009-01-03 | GSE13938 | GEO

Natural RNA polymerase aptamers regulate transcription in E. coli

Project description:Natural RNA polymerase aptamers regulate transcription in E. coli

| PRJNA385824 | ENA