Browse
Submit Data
Databases
API
Help

Dataset Information

22 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Reverse transcriptase loop-mediated isothermal amplification (RT-LAMP)-based diagnosis: A potential alternative to quantitative real-time PCR based detection of the novel SARS-COV-2 virus.

ABSTRACT: The sudden outbreak of the novel Coronavirus infectious disease (COVID-19) resulted in significant challenges to global health systems. One of the primary challenges is rapid, reliable, and accurate detection of the severe acute respiratory syndrome coronavirus 2 (SARS-COV-2) virus among the suspected COVID-19-infected individuals. At present, quantitative real-time PCR (qRT-PCR) is a widely used diagnostic method. However, it requires expensive instruments and expertise in the interpretation of results. These constraints reflect the significant need for the development of alternative diagnostic options. This study will validate the use and efficiency of the reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) assay as a potential alternative for the detection of COVID-19. For this purpose, a cohort of 297 suspected COVID-19 patients was tested using both the RT-LAMP assay and the conventional RT-PCR method. For the RT-LAMP assay, three genes (orf-1ab, N, and S) were identified as the target sites for the detection of COVID-19. Based on a comparative assessment, 117 out of 124 positive COVID-19 cases were observed using the RT-LAMP technique with an overall 91.45% sensitivity. Interestingly, where a consensus on 163 individuals free of SARS-Cov-2 was observed, RT-LAMP specificity was 90%. Based on these findings, the robustness of the technique, and the reduced dependency on expensive instrumentation, RT-LAMP-based COVID-19 detection is strongly recommended as a potential alternative assay.

SUBMITTER: Haq F

PROVIDER: S-EPMC7785420 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

A semi-automated, isolation-free, high-throughput SARS-CoV-2 reverse transcriptase (RT) loop-mediated isothermal amplification (LAMP) test.

Project description:Shortages of reverse transcriptase (RT)-polymerase chain reaction (PCR) reagents and related equipment during the COVID-19 pandemic have demonstrated the need for alternative, high-throughput methods for severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2)-mass screening in clinical diagnostic laboratories. A robust, SARS-CoV-2 RT-loop-mediated isothermal amplification (RT-LAMP) assay with high-throughput and short turnaround times in a clinical laboratory setting was established and compared to two conventional RT-PCR protocols using 323 samples of individuals with suspected SARS-CoV-2 infection. Limit of detection (LoD) and reproducibility of the isolation-free SARS-CoV-2 RT-LAMP test were determined. An almost perfect agreement (Cohen's kappa > 0.8) between the novel test and two classical RT-PCR protocols with no systematic difference (McNemar's test, P > 0.05) was observed. Sensitivity and specificity were in the range of 89.5 to 100% and 96.2 to 100% dependent on the reaction condition and the RT-PCR method used as reference. The isolation-free RT-LAMP assay showed high reproducibility (Tt intra-run coefficient of variation [CV] = 0.4%, Tt inter-run CV = 2.1%) with a LoD of 95 SARS-CoV-2 genome copies per reaction. The established SARS-CoV-2 RT-LAMP assay is a flexible and efficient alternative to conventional RT-PCR protocols, suitable for SARS-CoV-2 mass screening using existing laboratory infrastructure in clinical diagnostic laboratories.

| S-EPMC8560768 | biostudies-literature

One-Pot Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP) for Detecting MERS-CoV.

Project description:Due to the limitation of rapid development of specific antiviral drug or vaccine for novel emerging viruses, an accurate and rapid diagnosis is a key to manage the virus spread. We developed an efficient and rapid method with high specificity for the Middle East Respiratory Syndrome coronavirus (MERS-CoV), based on one-pot reverse transcription loop-mediated isothermal amplification (one-pot RT-LAMP). A set of six LAMP primers [F3, B3, FIP, BIP, LF (Loop-F), and LB (Loop-B)] were designed using the sequence of nucleocapsid (N) gene with optimized RT-LAMP enzyme conditions: 100 U M-MLV RTase and 4 U Bst polymerase, implying that the reaction was able to detect four infectious viral genome copies of MERS-CoV within a 60 min reaction time period. Significantly, EvaGreen dye has better signal read-out properties in one-pot RT-LAMP reaction and is more compatible with DNA polymerase than SYBR green I. Isothermally amplified specific N genes were further evaluated using field-deployable microchamber devices, leading to the specific identification of as few as 0.4 infectious viral genome copies, with no cross-reaction to the other acute respiratory disease viruses, including influenza type A (H1N1 and H3N2), type B, human coronavirus 229E, and human metapneumovirus. This sensitive, specific and feasible method provides a large-scale technical support in emergencies, and is also applied as a sample-to-detection module in Point of Care Testing devices.

| S-EPMC5220095 | biostudies-literature

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence.

Project description:BackgroundThe COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC).ResultThe results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500-5,000, 6,500-7,500, and 23,300-25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests.ConclusionThis study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

| S-EPMC10728416 | biostudies-literature

Detection of Novel duck reovirus (NDRV) using visual reverse transcription loop-mediated isothermal amplification (RT-LAMP).

Project description:Here we present a visual reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for detecting the gene encoding the ?B major outer-capsid protein of novel duck reovirus (NDRV). A set of primers, composed of two outer primers, two inner primers and two loop primers, was designed based on the gene of interest. The LAMP reaction was conducted in a traditional laboratory water bath at 65?°C for 50?min. We compared the performance of calcein/Mn2+ and SYBR Green I dyes, as well as electrophoresis on agarose gel stained with GoldView nucleic acid dye to detect the RT-LAMP-amplified products and all assays could be employed to discriminate between positive and negative specimens in visible or UV light. Our data showed that there is no cross-reaction with other viruses and the RT-LAMP technique displayed high sensitivity for detecting NDRV with a minimal detection limit of 200 fg RNA input. This assay was more sensitive than conventional PCR in detecting NDRV both in natural and experimental infection. In conclusion, the RT-LAMP technique was remarkably sensitive, specific, rapid, simple and profitable for the identification of NDRV.

| S-EPMC6145877 | biostudies-literature

Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP).

Project description:BACKGROUND: The first documented case of Middle East Respiratory Syndrome coronavirus (MERS-CoV) occurred in 2012, and outbreaks have continued ever since, mainly in Saudi Arabia. MERS-CoV is primarily diagnosed using a real-time RT-PCR assay, with at least two different genomic targets required for a positive diagnosis according to the case definition of The World Health Organization (WHO) as of 3 July 2013. Therefore, it is urgently necessary to develop as many specific genetic diagnostic methods as possible to allow stable diagnosis of MERS-CoV infections. METHODS: Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) is a genetic diagnostic method used widely for the detection of viral pathogens, which requires only a single temperature for amplification, and can be completed in less than 1 h. This study developed a novel RT-LAMP assay for detecting MERS-CoV using primer sets targeting a conserved nucleocapsid protein region. RESULTS: The RT-LAMP assay was capable of detecting as few as 3.4 copies of MERS-CoV RNA, and was highly specific, with no cross-reaction to other respiratory viruses. Pilot experiments to detect MERS-CoV from medium containing pharyngeal swabs inoculated with pre-titrated viruses were also performed. The RT-LAMP assay exhibited sensitivity similar to that of MERS-CoV real-time RT-PCR. CONCLUSIONS: These results suggest that the RT-LAMP assay described here is a useful tool for the diagnosis and epidemiologic surveillance of human MERS-CoV infections.

| S-EPMC4132226 | biostudies-literature

One-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) for detection of tomato torrado virus.

Project description:'Torrado' disease caused by tomato torrado virus (ToTV) is responsible for considerable losses in tomato production. Therefore, a one-step reverse transcription loop-mediated isothermal amplification protocol for early and fast detection of ToTV isolates has been developed. The RNA extracted from ToTV-infected plants was tested using this protocol with a set of six primers specific for the Vp35 coat protein gene sequence. The amplified products were analyzed using amplification curves, electrophoresis, and direct staining of DNA. The sensitivity of the protocol was tenfold higher than that of conventional RT-PCR. This new protocol is inexpensive, rapid, simple, and very sensitive.

| S-EPMC4839060 | biostudies-literature

Rapid detection of Akabane virus by a novel reverse transcription loop-mediated isothermal amplification assay (RT-LAMP).

Project description:BACKGROUND: Akabane disease, caused by Akabane virus, is an insect-transmitted disease of ruminants that is primarily characterized by fetal damage. METHODS AND RESULTS: In this study, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for rapid detection of Akabane virus was successfully developed. The primers were designed to target the highly conserved fragment of nucleoprotein from the Akabane virus. The results indicate that the assay is highly specific and sensitive with a detection limit of 5.0 TCID50/mL within a 60-min incubation time. A total of 126 abortive samples collected from Xinjiang province were detected by the established RT-LAMP. The results of RT-LAMP assay showed 96.8% agreement with the semi-nested RT-PCR. CONCLUSION: This study is to first to develop a rapid, sensitive, and accurate method for the detection of Akabane virus, which may be used to screen clinical samples in developing countries or regions.

| S-EPMC3848447 | biostudies-literature

RNA purification-free detection of SARS-CoV-2 using reverse transcription loop-mediated isothermal amplification (RT-LAMP).

Project description:BackgroundCurrent diagnosis of SARS-CoV-2 infection relies on RNA purification prior to amplification. Typical extraction methods limit the processing speed and turnaround time for SARS-CoV-2 diagnostic testing.MethodsHere, we applied reverse transcription loop-mediated isothermal amplification directly onto human clinical swabs samples to amplify the RNA from SARS-CoV-2 swab samples after processing with chelating resin.ResultsBy testing our method on 64 samples, we managed to develop an RT-LAMP assay with 95.9% sensitivity (95% CI 86 to 99.5%) and 100% specificity (95% CI 78.2-100%).ConclusionThe entire process including sample processing can be completed in approximately 50 min. This method has promising potential to be applied as a fast, simple and inexpensive diagnostic tool for the detection of SARS-CoV-2.

| S-EPMC8723997 | biostudies-literature

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) for rapid detection of viral hemorrhagic septicaemia virus (VHS).

Project description:A one step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for detection of viral hemorrhagic septicaemia virus (VHS). A set of six primers were designed, based on the G-protein sequence of the VHS virus serotypes (He, F1, 23.75, Klapmolle and Rindsholm). The assay was optimised to amplify VHS RNA by incubation at 63 degrees C for only 1h, and required only a simple water bath or heating block to provide a constant temperature of 63 degrees C. RT-LAMP amplification products were detected by visual inspection using SYBR Green I stain and had a ladder-like appearance when electrophoresed on an agarose gel. The detection limit of the RT-LAMP assay was found to be similar to the commonly used RT-PCR method: both methods detected VHS RNA at a dilution of 10(6). The assay was evaluated using clinical samples and the results indicated the suitability and simplicity of the test as a rapid, field diagnostic tool for VHS virus.

| S-EPMC7117309 | biostudies-literature

Detection of swine influenza virus in nasal specimens by reverse transcription-loop-mediated isothermal amplification (RT-LAMP).

Project description:Detection of swine influenza virus (SIV) in commercial swine herds is important for understanding the infection status of the herd and for controlling disease. Current molecular diagnostics require that specimens be submitted to a laboratory which provides results to the growers after some time which is generally too late to intercede in disease control. Moreover, current diagnostic assays are time-consuming, typically costly, and require skilled technical expertise. We have instituted a reverse transcription loop-mediated isothermal amplification (RT-LAMP) diagnostic assay based on conserved regions of the SIV matrix (M) gene and H1N1 hemagglutinin (HA) sequences. The RT-LAMP assay was optimized to use both colorimetric and fluorescent endpoints and was validated. The M and HA RT-LAMP assays have a limit-of-detection (LOD) sensitive to 11 and 8-log-fold dilutions of viral RNA, respectively, and are capable of discriminating between H1 and H3 strains of SIV. Additionally, the RT-LAMP assay was optimized for direct amplification of SIV from field samples without the need for viral RNA isolation. The direct RT-LAMP detected >86 % of qRT-PCR validated SIV samples, and >66 % of negative samples when spiked with viral RNA or SIV. The diagnostic RT-LAMP assay is a rapid, sensitive, specific, and cost-effective method for the detection of SIV in herds substantially aiding diagnosis and surveillance.

| S-EPMC7799534 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data