Browse
Submit Data
Databases
API
Help

Dataset Information

23 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Analyzing the G3BP-like gene family of Arabidopsis thaliana in early turnip mosaic virus infection.

ABSTRACT: The Arabidopsis thaliana genome encodes several genes that are known or predicted to participate in the formation of stress granules (SG). One family of genes encodes for Ras GTPase-activating protein-binding protein (G3BP)-like proteins. Seven genes were identified, of which one of the members was already shown to interact with plant virus proteins in a previous study. A phylogenetic and tissue-specific expression analysis, including laser-dissected phloem, by qRT-PCRs was performed and the sub-cellular localization of individual AtG3BP::EYFP fluorescent fusion proteins expressed in Nicotiana benthamiana epidermal cells was observed. Individual AtG3BP-protein interactions in planta were studied using the bimolecular fluorescence complementation approach in combination with confocal imaging in living cells. In addition, the early and late induction of G3BP-like expression upon Turnip mosaic virus infection was investigated by RNAseq and qRT-PCR. The results showed a high divergence of transcription frequency in the different plant tissues, promiscuous protein-protein interaction within the G3BP-like gene family, and a general induction by a viral infection with TuMV in A. thaliana. The information gained from these studies leads to a better understanding of stress granules, in particular their molecular mode of action in the plant and their role in plant virus infection.

SUBMITTER: Reuper H

PROVIDER: S-EPMC7838295 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Comparison of two Turnip mosaic virus P1 proteins in their ability to co-localize with the Arabidopsis thaliana G3BP-2 protein.

Project description:Turnip mosaic virus (TuMV), belonging to the genus Potyvirus (family Potyviridae), has a large host range and consists of a single-stranded positive sense RNA genome encoding 12 proteins, including the P1 protease. This protein which is separated from the polyprotein by cis cleavage at its respective C-terminus, has been attributed with different functions during potyviral infection of plants. P1 of Turnip mosaic virus (P1-TuMV) harbors an FGSF-motif and FGSL-motif at its N-terminus. This motif is predicted to be a binding site for the host Ras GTPase-activating protein-binding protein (G3BP), which is a key factor for stress granule (SG) formation in mammalian systems and often targeted by viruses to inhibit SG formation. We therefore hypothesized that P1-TuMV might interact with G3BP to control and regulate plant SGs to optimize cellular conditions for the production of viral proteins. Here, we analyzed the co-localization of the Arabidopsis thaliana G3BP-2 with the P1 of two TuMV isolates, namely UK 1 and DEU 2. Surprisingly, P1-TuMV-DEU 2 co-localized with AtG3BP-2 under abiotic stress conditions, whereas P1-TuMV-UK 1 did not. AtG3BP-2::RFP showed strong SGs formation after stress, while P1-UK 1::eGFP maintained a chloroplastic signal under stress conditions, the signal of P1-DEU 2::eGFP co-localized with that of AtG3BP-2::RFP. This indicates a specific interaction between P1-DEU 2 and the AtG3BP family which is not solely based on the canonical interaction motifs.

| S-EPMC7985126 | biostudies-literature

Arabidopsis DRB4 protein in antiviral defense against Turnip yellow mosaic virus infection.

Project description:RNA silencing is an important antiviral mechanism in diverse eukaryotic organisms. In Arabidopsis DICER-LIKE?4 (DCL4) is the primary antiviral Dicer, required for the production of viral small RNAs from positive-strand RNA viruses. Here, we showed that DCL4 and its interacting partner dsRNA-binding protein 4 (DRB4) participate in the antiviral response to Turnip yellow mosaic virus (TYMV), and that both proteins are required for TYMV-derived small RNA production. In addition, our results indicate that DRB4 has a negative effect on viral coat protein accumulation. Upon infection DRB4 expression was induced and DRB4 protein was recruited from the nucleus to the cytoplasm, where replication and translation of viral RNA occur. DRB4 was associated with viral RNA in vivo and directly interacted in vitro with a TYMV RNA translational enhancer, raising the possibility that DRB4 might repress viral RNA translation. In plants the role of RNA silencing in viral RNA degradation is well established, but its potential function in the regulation of viral protein levels has not yet been explored. We observed that severe infection symptoms are not necessarily correlated with enhanced viral RNA levels, but might be caused by elevated accumulation of viral proteins. Our findings suggest that the control of viral protein as well as RNA levels might be important for mounting an efficient antiviral response.

| S-EPMC3240694 | biostudies-literature

Roles and programming of Arabidopsis ARGONAUTE proteins during Turnip mosaic virus infection.

Project description:In eukaryotes, ARGONAUTE proteins (AGOs) associate with microRNAs (miRNAs), short interfering RNAs (siRNAs), and other classes of small RNAs to regulate target RNA or target loci. Viral infection in plants induces a potent and highly specific antiviral RNA silencing response characterized by the formation of virus-derived siRNAs. Arabidopsis thaliana has ten AGO genes of which AGO1, AGO2, and AGO7 have been shown to play roles in antiviral defense. A genetic analysis was used to identify and characterize the roles of AGO proteins in antiviral defense against Turnip mosaic virus (TuMV) in Arabidopsis. AGO1, AGO2 and AGO10 promoted anti-TuMV defense in a modular way in various organs, with AGO2 providing a prominent antiviral role in leaves. AGO5, AGO7 and AGO10 had minor effects in leaves. AGO1 and AGO10 had overlapping antiviral functions in inflorescence tissues after systemic movement of the virus, although the roles of AGO1 and AGO10 accounted for only a minor amount of the overall antiviral activity. By combining AGO protein immunoprecipitation with high-throughput sequencing of associated small RNAs, AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. These findings indicate that distinct AGO proteins function as antiviral modules, and provide a molecular explanation for the silencing suppressor activity of HC-Pro.

| S-EPMC4373807 | biostudies-literature

Comparison of endogenous and viral microRNA profile of Arabidopsis thaliana with and without Turnip Mosaic Virus infection.

Project description:Individual miRNA profile was identified for two Col-0 WT replicates and two Col-0 TuMV infected plant replicate samples, with 12-15 plants in each replicate.Comparison was done based on the microRNA expression profile in both biological replicates for infected and uninfected plant samples .

2010-06-27 | GSE22583 | GEO

Guanosine tetraphosphate modulates salicylic acid signalling and the resistance of Arabidopsis thaliana to Turnip mosaic virus.

Project description:Chloroplasts can act as key players in the perception and acclimatization of plants to incoming environmental signals. A growing body of evidence indicates that chloroplasts play a critical role in plant immunity. Chloroplast function can be regulated by the nucleotides guanosine tetraphosphate and pentaphosphate [(p)ppGpp]. In plants, (p)ppGpp levels increase in response to abiotic stress and to plant hormones which are involved in abiotic and biotic stress signalling. In this study, we analysed the transcriptome of Arabidopsis plants that over-accumulate (p)ppGpp, and unexpectedly found a decrease in the levels of a broad range of transcripts for plant defence and immunity. To determine whether (p)ppGpp is involved in the modulation of plant immunity, we analysed the susceptibility of plants with different levels of (p)ppGpp to Turnip mosaic virus (TuMV) carrying a green fluorescent protein (GFP) reporter. We found that (p)ppGpp accumulation was associated with increased susceptibility to TuMV and reduced levels of the defence hormone salicylic acid (SA). In contrast, plants with lower (p)ppGpp levels showed reduced susceptibility to TuMV, and this was associated with the precocious up-regulation of defence-related genes and increased SA content. We have therefore demonstrated a new link between (p)ppGpp metabolism and plant immunity in Arabidopsis.

| S-EPMC6638062 | biostudies-literature

Transcription profiling of Arabidopsis Potyvirus turnip mosaic virus infection stages

Project description:A model system of Potyvirus turnip mosaic virus and Arabidopsis was used in this experiment. GFP-tagged virus supplied a visualized marker for us to localize the viral infection foci and its expansion on leaf under UV light. Initially, we dissect an individual infection focus and its adjacent region into four parts and define those four parts as zone 0, 1, 2, and 3, which represented different viral infection stages respectively. Corresponding fours parts were also dissected from control plant treated with turnip leaf sap only. This process was replicated three times totally.

2006-12-01 | E-MEXP-509 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

2015-04-06 | GSE64911 | GEO

Turnip mosaic virus

Project description:siRNAs 15-29 nucleotides long with 100 percent hit to Turnip mosaic virus clone GBR98

| PRJNA113381 | ENA

Comparison of endogenous and viral microRNA profile of Arabidopsis thaliana with and without Turnip Mosaic Virus infection.

2010-06-27 | E-GEOD-22583 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data