Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
PROVIDER: GSE64911 | GEO | 2015/04/06
SECONDARY ACCESSION(S): PRJNA272491
REPOSITORIES: GEO
Similar Datasets
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:In response to a viral infection, the plant’s RNA silencing machinery processes viral RNAs into a huge number of small interfering RNAs (siRNAs). However, very few of these siRNAs actually interfere with viral replication. A reliable approach to define the characteristics underlying the activity of these immunologically effective siRNAs (esiRNAs) has not been available so far. We developed a novel screening approach that enables a rapid functional identification of antiviral esiRNAs. The approach is essentially based on the use of a cytoplasmic extract from Nicotiana tabacum BY-2 protoplasts (BY-2 lysate, BYL), that shows Dicer-like (DCL) activity and facilitates the assembly of active RNA-induced silencing complexes (RISC) with an in vitro-translated Argonaute (AGO) protein of choice. We exposed double-stranded (ds) RNA of Tomato bushy stunt virus (TBSV) to the BYL to generate viral siRNAs (DCL assay). Total RNA was isolated from the reactions and DCL-generated TBSV siRNAs were identified by NGS. In another approach, AGO1/RISC- or AGO2/RISC-associated siRNAs were isolated using FLAG-AGO immunoprecipitation (AGO-IP) and analyzed by NGS. Subsequently, the antiviral activity of siRNAs with high affinity to AGO proteins was characterized in vitro and in vivo.
2019-10-01 | GSE121644 | GEO
Project description:The shoot apical meristem (SAM) comprises a group of undifferentiated cells that divide to maintain the plant meristem and also give rise to all shoot organs. SAM fate is specified by class III HOMEODOMAIN-LEUCINE ZIPPER (HD-ZIP III) transcription factors, which are targets of miR166/165. In Arabidopsis, AGO10 is a critical regulator of SAM maintenance, and here we demonstrate that AGO10 specifically interacts with miR166/165. The association is determined by a distinct structure of the miR166/165 duplex. Deficient loading of miR166 into AGO10 results in a defective SAM. Notably, the miRNA-binding ability of AGO10, but not its catalytic activity, is required for SAM development, and AGO10 has a higher binding affinity for miR166 than does AGO1, a principal contributor to miRNA-mediated silencing. We propose that AGO10 functions as a decoy for miR166/165 to maintain the SAM, preventing their incorporation into AGO1 complexes and the subsequent repression of HD-ZIP III gene expression. Homozygous T2 progeny of complemented plants expressing ago10-3;PAGO10-HF-AGO10 and ago1;PAGO1-HF-AGO1 were used for preparation of AGO complexes. Flower samples including floral buds, open flowers, and newly set siliques (1-2 day old) were collected for protein extraction and isolation of dual-tagged AGO complexes using a two-step affinity purification. The isolated AGO complexes were divided into two parts, one aliquot was used for sRNA extraction with Trizol reagent, whereas the other part was used for monitoring protein purity by Gelcode blue staining and western blot using a monoclonal anti-Flag antibody (Sigma) as previous described.
2012-08-03 | E-GEOD-39885 | biostudies-arrayexpress
Project description:AGO 1 IMMUNOPRECIPITATION MICROARRAYS
| PRJNA123389 | ENA
Project description:Transposable elements (TEs) and repetitive sequences comprise over 40% of rice genome. Different TEs are tightly regulated by distinct epigenetic mechanisms. For example, the activities of LTR retrotransposon Tos17 and non-LTR retrotransposon LINE element Karma are uniquely regulated by histone H3K9 methylation and histone H3K4 demethylation, respectively. Miniature inverted repeat transposable elements (MITEs) are one of the most high-copy-number DNA transposons, which are interspersed around rice genome and might influence nearby gene expression. In plants, 24-nucleotide (24-nt) heterochromatic small interfering RNAs (hc-siRNAs) derived from repeats and TEs. To what extent hc-siRNA associated TEs affect gene expression and therefore contribute to agricultural traits in rice remains elusive. Here, we show that OsDCL3a, one of Dicer-Like 3 (DCL3) homolog, is primarily responsible for 24-nt hc-siRNA processing in rice. Impaired OsDCL3a displayed altered important agricultural traits in rice. We found that genome-wide (281,563) 24-nt hc-siRNA clusters were OsDCL3a-dependent, among which MITEs were significantly enriched. Impaired OsDCL3a caused significant overlapping between reduced hc-siRNAs from MITEs and elevated nearby gene expression. Intriguingly, genes involved in Gibberellin and Brassinosteroid homeostasis were identified as direct targets of OsDCL3a, which may attribute to dwarfism and enlarged flag leaf angle upon OsDCL3a deficiency. Our work uncovers OsDCL3a-dependent hc-siRNAs derived from MITEs as broad spectrum of regulators for fine-tuning gene expression, and this observation may reflect a conserved mechanism in other higher plants with dispersed repeat- or TE-rich genomes. Examination of OsDCL3a-dependent hc-siRNAs derived from MITEs.
2014-02-04 | E-GEOD-50778 | biostudies-arrayexpress
Project description:Individual miRNA profile was identified for two Col-0 WT replicates and two Col-0 TuMV infected plant replicate samples, with 12-15 plants in each replicate.Comparison was done based on the microRNA expression profile in both biological replicates for infected and uninfected plant samples .
2010-06-27 | GSE22583 | GEO
Project description:RNA interference (RNAi) is a cell-intrinsic antiviral defense conserved in diverse organisms. However, the mechanism by which mammalian antiviral RNAi is regulated is largely unknown. Herein, we uncover that STUB1, an E3 ubiquitin ligase, interacts with and ubiquitinates AGO2, the core component of RNAi pathway, resulting in the degradation of AGO2 via ubiquitin-proteasome system. Additionally, STUB1 can induce the degradation of the other mammalian AGO proteins including AGO1, AGO3, and AGO4. Our further study reveals that STUB1 also interacts with and mediates the ubiquitination of Dicer, the endoribonuclease responsible for siRNA or miRNA biogenesis, via K48-linked poly-ubiquitin, which induces the degradation of Dicer and its specialized form, termed antiviral Dicer (aviDicer) that usually expresses in stem cells. Loss of STUB1 upregulated Dicer and AGO2, thereby enhancing antiviral RNAi to effectively inhibit viral RNA replication in mammalian cells. In vivo, the STUB1 deficiency markedly enhanced the production of virus-derived siRNAs and elicited a potent antiviral effect against Enterovirus-A71 (EV-A71) infection in newborn mouse. Our findings demonstrate STUB1 as a novel negative regulator of RNAi by mediating the ubiquitination and degradation of Dicer and AGO proteins, and provide novel insights into the regulatory mechanism of antiviral RNAi in mammals.
2021-11-22 | GSE189203 | GEO
Project description:Plants and invertebrates protect themselves from viruses through RNA interference (RNAi), yet it remains unknown whether this defense mechanism exists in mammals. Antiviral RNAi involves the processing of viral long double-stranded (ds) RNA molecules into small interfering RNAs (siRNAs) by the ribonuclease (RNAse) III Dicer. These siRNAs are incorporated into effector complex(es) containing members of the Argonaute (Ago) protein family and guide silencing of complementary target viral RNAs. Here, we detect the accumulation of phased Dicer-dependent virus-derived siRNA (viRNAs) and demonstrate their loading into Ago2 after infection of mouse embryonic stem (ES) cells with Encephalomyocarditis virus (EMCV). We further show that the production of these viRNAs is drastically reduced, yet not completely abolished, if ES cells are first induced to differentiate before infection. Finally, we reveal that the mammalian virus Nodamura virus (NoV) encodes for a protein that counteracts such antiviral RNAi in ES cells supporting the existence of an effective RNAi-based immunity in mammals. Infection of wild-type or mutant mouse ES cells and analysis of small RNAs from total extracts or immunoprecipitated components of the RNAi pathway
2013-10-10 | E-GEOD-43153 | biostudies-arrayexpress
Project description:Plants and invertebrates protect themselves from viruses through RNA interference (RNAi), yet it remains unknown whether this defense mechanism exists in mammals. Antiviral RNAi involves the processing of viral long double-stranded (ds) RNA molecules into small interfering RNAs (siRNAs) by the ribonuclease (RNAse) III Dicer. These siRNAs are incorporated into effector complex(es) containing members of the Argonaute (Ago) protein family and guide silencing of complementary target viral RNAs. Here, we detect the accumulation of phased Dicer-dependent virus-derived siRNA (viRNAs) and demonstrate their loading into Ago2 after infection of mouse embryonic stem (ES) cells with Encephalomyocarditis virus (EMCV). We further show that the production of these viRNAs is drastically reduced, yet not completely abolished, if ES cells are first induced to differentiate before infection. Finally, we reveal that the mammalian virus Nodamura virus (NoV) encodes for a protein that counteracts such antiviral RNAi in ES cells supporting the existence of an effective RNAi-based immunity in mammals.
2013-10-10 | GSE43153 | GEO
Project description:RNA interference (RNAi) functions as a potent antiviral immunity in plants and invertebrates, however whether RNAi plays antiviral roles in mammals remains unclear. Here, using human enterovirus 71 (HEV71) as a model, we showed HEV71 3A protein as an authentic viral suppressor of RNAi during viral infection. When the 3A-mediated RNAi suppression was impaired, the mutant HEV71 readily triggered the production of abundant HEV71-derived small RNAs with canonical siRNA properties in cells and mice. These virus-derived siRNAs were produced from viral dsRNA replicative intermediates in a Dicer-dependent manner, loaded into AGO, and were fully active in degrading cognate viral RNAs. Recombinant HEV71 deficient in 3A-mediated RNAi suppression was significantly restricted in human somatic cells and mice, whereas Dicer-deficiency rescued HEV71 infection independently of type I interferon response. Thus, RNAi can function as an antiviral immunity, which is induced and suppressed by a human virus, in mammals.
2017-08-01 | GSE99252 | GEO