Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Comparison of endogenous and viral microRNA profile of Arabidopsis thaliana with and without Turnip Mosaic Virus infection.

ABSTRACT: Individual miRNA profile was identified for two Col-0 WT replicates and two Col-0 TuMV infected plant replicate samples, with 12-15 plants in each replicate.Comparison was done based on the microRNA expression profile in both biological replicates for infected and uninfected plant samples .

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE22583 | GEO | 2010/06/27

SECONDARY ACCESSION(S): PRJNA128401

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Comparison of endogenous and viral microRNA profile of Arabidopsis thaliana with and without Turnip Mosaic Virus infection.

Project description:Individual miRNA profile was identified for two Col-0 WT replicates and two Col-0 TuMV infected plant replicate samples, with 12-15 plants in each replicate.Comparison was done based on the microRNA expression profile in both biological replicates for infected and uninfected plant samples . 12-15 plants were used in all sample replicates independently.

2010-06-27 | E-GEOD-22583 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

2015-04-06 | GSE64911 | GEO

The effect of TuMV on translation initiation in Arabidopsis

Project description:Arabidopsis ecotype Col-0 expressing RPL18 fused to His & Flag epitopes (RPL18-HF) under 35S control was used to discern the effects of Turnip mosaic virus (TuMV) infection on host translation initiation. Plants were grown in LC-1 soil in 12 hour days and infected by TuMV-GFP or mock-inoculated just prior to sending up bolts. Samples were taken from rosette leaves 10 days after inoculation. Only tissue fluorescing GFP was selected from the virus-infected samples. Similar tissue was sampled from mock-infected leaves. FLAG antibody was used to isolate RPL18-HF. The RNA co-immunoprecipitated with RPL18-HF is fully translation-initiated. This translation-initiated RNA, also referred to as polysomal RNA, was isolated and compared to total RNA under both mock and TuMV-infected states to find TuMV-induced changes in host translation initiation. ****[PLEXdb(http://www.plexdb.org) has submitted this series at GEO on behalf of the original contributor, Jackson Moeller. The equivalent experiment is AT42 at PLEXdb.]

2011-03-11 | GSE20278 | GEO

sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

| PRJNA434890 | ENA

The effect of TuMV on translation initiation in Arabidopsis

2011-03-11 | E-GEOD-20278 | biostudies-arrayexpress

WTv.AOXantisense

Project description:Leaf transcriptome comparison of untransformed Col-0 Arabidopsis plants with plants transformed to be anti-sense for AtAOX1a (alternative oxidase). Two “bio-replicates” were sampled, for a total of four microarray chips—Col-0 and anti-sense leaf tissue from a first planting (samples GSM45208 and GSM45231, respectively), and from a second planting made one week later (samples GSM45209 and GSM45278, respectively). See sample descriptions for growth conditions and microarray procedure. Keywords = alternative oxidase Keywords = plant mitochondria Keywords = respiration Keywords = leaves Keywords: repeat sample

2005-04-04 | GSE2406 | GEO

Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

| PRJNA704624 | ENA

Endogenous hairpins-ir71 targets : Gene profiling of Turnip Crinkle Virus (TCV) siRNA in mutants.

Project description:gnp06-03_microtrac Endogenous hairpins-ir71 targets What are the genes (including miRNA precursors) that are differentially regulated in a set of viral siRNA in diferent mutants? Lines IR71 KO n°3 and Col-0 were grown on soil until bolting, Flower buds were then harvested and RNA extracted with Qiagen RNeasy Plant mini kit. RNA was stored at -20°C.

2012-12-31 | GSE34653 | GEO

Transcription profiling of Arabidopsis Potyvirus turnip mosaic virus infection stages

Project description:A model system of Potyvirus turnip mosaic virus and Arabidopsis was used in this experiment. GFP-tagged virus supplied a visualized marker for us to localize the viral infection foci and its expansion on leaf under UV light. Initially, we dissect an individual infection focus and its adjacent region into four parts and define those four parts as zone 0, 1, 2, and 3, which represented different viral infection stages respectively. Corresponding fours parts were also dissected from control plant treated with turnip leaf sap only. This process was replicated three times totally.

2006-12-01 | E-MEXP-509 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data