Dataset Information

The functional landscape of Golgi membrane protein 1 (GOLM1) phosphoproteome reveal GOLM1 regulating P53 that promotes malignancy.

ABSTRACT: Golgi membrane protein 1 (GOLM1) was implicated in carcinogenesis of multiple types of cancer. However, Phosphoproteome landscapes of GOLM1 overexpression in lung cancer remain largely unknown. In this study, using data from the Cancer Genome Atlas (TCGA) and phosphoproteome, we systematically evaluated the feature of GOLM1 and studied its prognostic value in non-small cell lung cancer (NSCLC). The proliferation, migration, and invasion capacities in PC9 cell with GOLM1 overexpression were determined using Trans-well system assay. Tumor engrafts was visualized in mice models and confirmed by ex vivo. An increased expression of GOLM1 had shorter overall survival (OS) in patients with NSCLC in TCGA database. GOLM1 in single gene set enrichment analysis (GSEA) related to adherent's junction, cell cycle, and pathway in cancer. Overexpression of GOLM1 in GOLM1OE PC9 cells promoted cell proliferation, migration, and invasion. Decreased migration and invasion potential were also observed in knockdown of GOLM1 in GOLM1KD PC9 cells in migration assay. An increased expression of GOLM1 could significantly increase the growth of tumor in xenograft mice models. phosphoproteome analysis showed 239 upregulated and 331 downregulated Phosphorylated proteins in GOLM1OE PC9 cells. Overexpression of GOLM1 in GSEA was significantly related to P53 in MAPK signaling pathway. Overexpression of GOLM1enhanced the phosphorylation of P53 protein at site S315 but inhibited the formation of P53 tetramers. These results indicate that overexpression GOLM1 enhances non-small-cell carcinoma aggressiveness through inhibited the formation of P53 tetramer.

SUBMITTER: Song Q

PROVIDER: S-EPMC7921442 | biostudies-literature | 2021 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

The functional landscape of Golgi membrane protein 1 (GOLM1) phosphoproteome reveal GOLM1 regulating P53 that promotes malignancy.

Song Qi Q He Xiang X Xiong Ying Y Wang Junlan J Zhang Lei L Leung Elaine Lai-Han EL Li Guoping G

Cell death discovery 20210301 1

Golgi membrane protein 1 (GOLM1) was implicated in carcinogenesis of multiple types of cancer. However, Phosphoproteome landscapes of GOLM1 overexpression in lung cancer remain largely unknown. In this study, using data from the Cancer Genome Atlas (TCGA) and phosphoproteome, we systematically evaluated the feature of GOLM1 and studied its prognostic value in non-small cell lung cancer (NSCLC). The proliferation, migration, and invasion capacities in PC9 cell with GOLM1 overexpression were deter ...[more]

PMID: 33649292

Similar Datasets

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

The functional landscape of Golgi membrane protein 1 (GOLM1) phosphoproteome reveal GOLM1 regulating P53 that promotes malignancy.

Publications

The functional landscape of Golgi membrane protein 1 (GOLM1) phosphoproteome reveal GOLM1 regulating P53 that promotes malignancy.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets