Molecular characterization of an avian GA13-like infectious bronchitis virus full-length genome from Costa Rica.
Ontology highlight
ABSTRACT:
SUBMITTER: Villalobos-Aguero RA
PROVIDER: S-EPMC8052201 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:Infectious bronchitis virus (IBV) produces infectious bronchitis (IB) disease in poultry worldwide. In spite of proper vaccinations against the IBV, new IBV strains are continually emerging worldwide. In this study, a new highly virulent nephropathogenic IBV strain named CK/CH/XDC-2/2013 was identified from a vaccinated flock with clinical signs of IB in the Jiangsu province of China. The full-length genome sequence of the isolate was 27,714 nucleotides long, and the genome was organized similarly to classical IBV strains. Minimum divergence, phylogenetic analysis, and distance matrix of the genome showed that the CK/CH/XDC-2/2013 isolate had the highest similarity to the IBV BJ strain. The spike glycoprotein (S) gene had the greatest similarity to the nephropathogenic BJ strain and showed an 8 amino acid insertion (YSNGNSDV) at 73 to 80 sites and 3 amino acid deletion at sites 126 to 128 compared to the IBV vaccine strains. A recombination analysis of the S gene showed that the new isolate evolved from the IBV BJ strain and the KM91 vaccine strain. An animal challenge experiment showed a mortality of 60 to 80% in early-age chickens by different inoculation routes. Pathological examinations of the kidneys revealed inflammation, distention with uric acid deposits, and tubular degeneration. It indicated that the CK/CH/XDC-2/2013 isolate has robust kidney tissue tropism, and new nephropathogenic IBV strains are continuously evolving in China.
| S-EPMC7127410 | biostudies-literature
Project description:Avian infectious bronchitis virus (IBV) is causing considerable economic losses in the world poultry industry. The main difficulty of prevention and control of IB disease is the numerous genotypes and serotypes. The genetic analysis of IBV was mainly based on the S1 gene which played an important role in infectivity. In the study, One hundred and thirty-nine strains of avian infectious bronchitis virus were isolated from chickens showing signs of disease in southern China during the period from April 2019 to March 2020. The nucleotide and amino acid sequences from the isolated field strains were compared to 22 published references. Nucleotide homologies ranged from 64.5% to 100% and amino acid homologies ranging from 70% to 99.8%. Six genotype IBV strains were co-circulating in southern China. QX-type was still the most dominant genotype. Alignment of nucleotide and amino acid sequences of S1 gene revealed that the substitutions, insertions and deletions are widely among isolated strains. Recombination analysis showed that there is a large number of recombinant strains amongst these isolates, forming new sub branches, subtypes and variants. Therefore, long-term continuing surveillance is necessary for IBV prevention and control.
| S-EPMC8192861 | biostudies-literature
Project description:Avian infectious bronchitis (IB) is caused by avian infectious bronchitis virus (IBV) belonging to Coronaviridae family. The disease is prevalent in all countries with almost 100% incidence rate. Chicken and commercially reared pheasant are the natural host for IBV. Virus causes respiratory diseases, poor weight gain, feed efficiency in broiler, damage to oviduct, and abnormal egg production in mature hens resulting in economic losses. IBV also replicates in tracheal and renal epithelial cells leading to prominent tracheal and kidney lesions. Virus undergoes spontaneous mutation leading to continual emergence of new variants. The effectiveness of immunization program is diminished because of poor cross-protection among the serotypes. Identification of circulating serotypes is important in controlling IBV infection. Toll-like receptor 3 (TLR3) and TLR21 are involved in early recognition of virus resulting in induction of inflammatory cytokines. Both humoral and cellular immune responses are important in the control of infection. Humoral immunity plays an important role in recovery and clearance of viral infection. IBV-specific cytotoxic T lymphocytes induce lysis of IBV-infected cells. Effective diagnostic tools are required at field level to identify different IBV variants. Embryonated chicken eggs are effective model for virus isolation. Identification by other specific methods like virus neutralization (VN), hemagglutination inhibition (HI), enzyme linked immunosorbent assay (ELISA), immunohistochemistry, or nucleic acid analysis or by electron microscopy is also indispensable. VN test in tracheal organ culture is the best method for antigenic typing for surveillance purposes. Continuous epidemiological surveillance, strict biosecurity measures, and vaccine effective against various serotypes are necessary for controlling IB in chickens.
| S-EPMC7120852 | biostudies-literature
Project description:Avian infectious bronchitis virus (IBV) is responsible of significant economic losses for poultry industry around the world, through evolution of its pathogenicity, inadequacy of vaccines, and virus evasion. Such evasion is related to the unstable nature of its RNA, in particular the S glycoprotein encoding gene, which raises great challenges with regard to the control of the disease, along with the lack of proof reading mechanisms of the RNA polymerase. The emergence of new variants might be a reason for the endemic outbreaks that are being reported in Tunisia, in addition to poor vaccination techniques and ineffective prophylactic programs. In the present study, partial nucleotide sequences of the S1 glycoprotein gene and the 3'-untranslated region (UTR) of 2 Tunisian isolates, TN1011/16 and TN1012/16, identified in 2016, were determined. Specific mutations were found in S1 gene as well as in 3'UTR region. Phylogenetic analysis of the S1 nucleotide sequences showed that both isolates are closely related to the Algerian strains, and formed a common cluster within the genotype I. In addition, these isolates were non-recombinant ones, confirming that they are unique variants. Based on their S1 gene sequences, TN1011/16 and TN1012/16 strains were distant from the H120 vaccine strain, commercially used in Tunisia along with the variant vaccine 793B type (4/91). A comparison between nucleotide sequences of their 3'UTR region and S1 gene showed a difference in IBV classification. The obtained results have confirmed that the IBVsequence continues to drift and brings valuable information in relation with its evolution, vaccine development and better control of the disease.
| S-EPMC7107247 | biostudies-literature
Project description:A rapid and sensitive method for the detection and unambiguous typing of infectious bronchitis virus (IBV) is described. RNA was isolated from IBV-infected allantoic fluid and was transcribed into cDNA. This cDNA was amplified by the polymerase chain reaction. The polymerase chain reaction products were subsequently analyzed on an agarose gel. The presence of IBV-specific RNA in the allantoic fluid then allowed the amplification of a 438-bp DNA fragment from the nucleocapsid (N) gene. For the typing of IBV isolates, we used amplified double-stranded DNA as a template in a sequencing reaction. We report 360 bases of the N gene of 18 IBV isolates. The sequence of the N gene was different between serologically indistinguishable IBV strains and may be a valuable tool in epidemiologic studies. A phylogenetic tree that was based on the sequences obtained did not agree with trees that were based on other parts of the sequence, illustrating the high frequency of recombination between IBV strains.
| S-EPMC265000 | biostudies-other
Project description:Respiratory diseases like infectious bronchitis virus (IBV) and avian metapneumovirus (aMPV) have been held accountable for major losses for poultry production. Nevertheless, scarce information was present dealing with the prevalence and molecular epidemiology of these infections in Greece and the efficacy of currently applied control strategies. To fill this gap, a specific epidemiological study was designed. A total of 106 broiler and layer farms, including 10 backyard and 96 commercial flocks, were sampled between March 2016 and May 2017, and the obtained tracheal swabs were tested for IBV and aMPV using RT-PCR based techniques followed by sequencing. For each farm, data regarding production type, flock features, clinical signs, and vaccination program were also recorded. Different associations between vaccination protocol, production type, animal category, birds density, age, presence of clinical signs, and IBV and/or aMPV infection were tested. Both IBV and aMPV field strain prevalence were proven high, approximately 20 and 30%, respectively, being the GI-19 lineage (14 out of 19; 73.6%) and B subtype (30 out of 30; 100%), the most commonly detected IBV and aMPV genetic types. Infection with IBV field strains was significantly associated with clinical sign presence (odds ratio = 8.55 [95CI = 2.17-42.90]). Remarkably, only the vaccination protocol involving a double vaccination at 1 D of age was proven protective against IBV-induced symptomatology, with the odds of developing disease being 4.14 [95CI = 1.34-14.51] times lower. No association was demonstrated between aMPV infection and clinical outbreaks or between aMPV and IBV detection, suggesting the marginal role of the former pathogen in poultry farming. Globally, the present study provides the first detailed investigation of the epidemiological scenario of 2 viruses traditionally considered of pivotal relevance in poultry farming and demonstrates that remarkable benefits could be obtained with just minor adjustments in vaccination protocols.
| S-EPMC7107232 | biostudies-literature
Project description:Recombination in the family Coronaviridae has been well documented and is thought to be a contributing factor in the emergence and evolution of different coronaviral genotypes as well as different species of coronavirus. However, there are limited data available on the frequency and extent of recombination in coronaviruses in nature and particularly for the avian gamma-coronaviruses where only recently the emergence of a turkey coronavirus has been attributed solely to recombination. In this study, the full-length genomes of eight avian gamma-coronavirus infectious bronchitis virus (IBV) isolates were sequenced and along with other full-length IBV genomes available from GenBank were analyzed for recombination. Evidence of recombination was found in every sequence analyzed and was distributed throughout the entire genome. Areas that have the highest occurrence of recombination are located in regions of the genome that code for nonstructural proteins 2, 3 and 16, and the structural spike glycoprotein. The extent of the recombination observed, suggests that this may be one of the principal mechanisms for generating genetic and antigenic diversity within IBV. These data indicate that reticulate evolutionary change due to recombination in IBV, likely plays a major role in the origin and adaptation of the virus leading to new genetic types and strains of the virus.
| S-EPMC3187689 | biostudies-literature
Project description:Infectious bronchitis virus (IBV) is a positive-sense, single-stranded, enveloped RNA virus responsible for substantial economic losses to the poultry industry worldwide by causing a highly contagious respiratory disease. The virus can spread quickly through contact, contaminated equipment, aerosols, and personal-to-person contact. We highlight the prevalence and geographic distribution of all nine genotypes, as well as the relevant symptoms and economic impact, by extensively analyzing the current literature. Moreover, phylogenetic analysis was performed using Molecular Evolutionary Genetics Analysis (MEGA-6), which provided insights into the global molecular diversity and evolution of IBV strains. This review highlights that IBV genotype I (GI) is prevalent worldwide because sporadic cases have been found on many continents. Conversely, GII was identified as a European strain that subsequently dispersed throughout Europe and South America. GIII and GV are predominant in Australia, with very few reports from Asia. GIV, GVIII, and GIX originate from North America. GIV was found to circulate in Asia, and GVII was identified in Europe and China. Geographically, the GVI-1 lineage is thought to be restricted to Asia. This review highlights that IBV still often arises in commercial chicken flocks despite immunization and biosecurity measures because of the ongoing introduction of novel IBV variants and inadequate cross-protection provided by the presently available vaccines. Consequently, IB consistently jeopardizes the ability of the poultry industry to grow and prosper. Identifying these domains will aid in discerning the pathogenicity and prevalence of IBV genotypes, potentially enhancing disease prevention and management tactics.
| S-EPMC10875066 | biostudies-literature
Project description:One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.
| S-EPMC7165564 | biostudies-literature
Project description:Background:Infectious bronchitis virus (IBV) is the etiological agent of an acute and highly contagious disease. Infectious bronchitis (IB) affects chicken of all ages and poses major economic loses to the poultry industry worldwide. The continuous evolution of the spike protein (S1) of IBV is responsible for the prevalence of many serotypes/genotypes around the world. Multiple lineages of IBV strains have been detected in chicken flocks in India since 2003. Aims:To detect IBV genotypes prevalent in India. Methods:Organ samples from 20 IBV-positive flocks with variable clinical signs were used for the amplification of the S1 gene of IBV by reverse transcriptase-polymerase chain reaction (RT-PCR). Results:Positive PCR amplicons were sequenced. Sequence analysis showed that 14 field isolates belonged to the GI-1 genetic lineage (Mass 41 serotype), two field isolates belonged to the GI-13 (UK 4/91 variant IBV strain), one field isolate grouped with GIII, GV, and GVI genetic lineage and three belonged to a variant genotype unique to India (GI-24). Phylogenetic analysis also showed a similar type of grouping within the field isolates. Among the fourteen GI-1 isolates, 12 were isolated between 2003 and 2006 and only two were isolated between 2009 and 2011. The two field isolates belonging to GI-13 were isolated in 2007, another one belonging to GIII, GV, and GVI was isolated in 2010 and three field isolates were not close to any reference IBV sequences isolated in 2006 (IND-TN-168-06), 2010 (IND-TN-280-10) and 2011 (IND-TN-290-11). Conclusion:A unique variant of IBV is emerging in India (GI-24). Our findings will have important implications for future vaccine intervention.
| S-EPMC7183371 | biostudies-literature