Browse
Submit Data
Databases
API
Help

Dataset Information

7 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Evolution of KIPPIS as a versatile platform for evaluating intracellularly functional peptide aptamers

ABSTRACT: Chimeric proteins have been widely used to evaluate intracellular protein–protein interactions (PPIs) in living cells with various readouts. By combining an interleukin-3-dependent murine cells and chimeric proteins containing a receptor tyrosine kinase c-kit, we previously established a c-kit-based PPI screening (KIPPIS) system to evaluate and select protein binders. In the KIPPIS components, proteins of interest are connected with a chemically inducible helper module and the intracellular domain of the growth-signaling receptor c-kit, which detects PPIs based on cell proliferation as a readout. In this system, proteins of interest can be incorporated into chimeric proteins without any scaffold proteins, which would be advantageous for evaluating interaction between small peptides/domains. To prove this superiority, we apply KIPPIS to 6 peptide aptamer–polypeptide pairs, which are derived from endogenous, synthetic, and viral proteins. Consequently, all of the 6 peptide aptamer–polypeptide interactions are successfully detected by cell proliferation. The detection sensitivity can be modulated in a helper ligand-dependent manner. The assay results of KIPPIS correlate with the activation levels of Src, which is located downstream of c-kit-mediated signal transduction. Control experiments reveal that KIPPIS clearly discriminates interacting aptamers from non-interacting ones. Thus, KIPPIS proves to be a versatile platform for evaluating the binding properties of peptide aptamers.

SUBMITTER: Kashima D

PROVIDER: S-EPMC8175380 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Evolution of a split RNA polymerase as a versatile biosensor platform.

Project description:Biosensors that transduce target chemical and biochemical inputs into genetic outputs are essential for bioengineering and synthetic biology. Current biosensor design strategies are often limited by a low signal-to-noise ratio, the extensive optimization required for each new input, and poor performance in mammalian cells. Here we report the development of a proximity-dependent split RNA polymerase (RNAP) as a general platform for biosensor engineering. After discovering that interactions between fused proteins modulate the assembly of a split T7 RNAP, we optimized the split RNAP components for protein-protein interaction detection by phage-assisted continuous evolution (PACE). We then applied the resulting activity-responsive RNAP (AR) system to create biosensors that can be activated by light and small molecules, demonstrating the 'plug-and-play' nature of the platform. Finally, we validated that ARs can interrogate multidimensional protein-protein interactions and trigger RNA nanostructure production, protein synthesis, and gene knockdown in mammalian systems, illustrating the versatility of ARs in synthetic biology applications.

| S-EPMC5823606 | biostudies-literature

Aptamers: versatile molecular recognition probes for cancer detection.

Project description:In the past two decades, aptamers have emerged as a novel class of molecular recognition probes comprising uniquely-folded short RNA or single-stranded DNA oligonucleotides that bind to their cognate targets with high specificity and affinity. Aptamers, often referred to as "chemical antibodies", possess several highly desirable features for clinical use. They can be chemically synthesized and are easily conjugated to a wide range of reporters for different applications, and are able to rapidly penetrate tissues. These advantages significantly enhance their clinical applicability, and render them excellent alternatives to antibody-based probes in cancer diagnostics and therapeutics. Aptamer probes based on fluorescence, colorimetry, magnetism, electrochemistry, and in conjunction with nanomaterials (e.g., nanoparticles, quantum dots, single-walled carbon nanotubes, and magnetic nanoparticles) have provided novel ultrasensitive cancer diagnostic strategies and assays. Furthermore, promising aptamer targeted-multimodal tumor imaging probes have been recently developed in conjunction with fluorescence, positron emission tomography (PET), single-photon emission computed tomography (SPECT), and magnetic resonance imaging (MRI). The capabilities of the aptamer-based platforms described herein underscore the great potential they hold for the future of cancer detection. In this review, we highlight the most prominent recent developments in this rapidly advancing field.

| S-EPMC4701644 | biostudies-other

claMP Tag: a versatile inline metal-binding platform based on the metal abstraction peptide.

Project description:Molecularly targeted research and diagnostic tools are essential to advancing understanding and detection of many diseases. Metals often impart the desired functionality to these tools, and conjugation of high-affinity chelators to proteins is carried out to enable targeted delivery of the metal. This approach has been much more effective with large lanthanide series metals than smaller transition metals. Because chemical conjugation requires additional processing and purification steps and yields a heterogeneous mixture of products, inline incorporation of a peptide tag capable of metal binding is a highly preferable alternative. Development of a transition metal binding tag would provide opportunity to greatly expand metal-based analyses. The metal abstraction peptide (MAP) sequence was genetically engineered into recombinant protein to generate the claMP Tag. The effects of this tag on recombinant epidermal growth factor (EGF) protein expression, disulfide bond formation, tertiary structural integrity, and transition metal incorporation using nickel were examined to confirm the viability of utilizing the MAP sequence to generate linker-less metal conjugates.

| S-EPMC4215913 | biostudies-other

Robust suppression of HIV replication by intracellularly expressed reverse transcriptase aptamers is independent of ribozyme processing.

Project description:RNA aptamers that bind human immunodeficiency virus 1 (HIV-1) reverse transcriptase (RT) also inhibit viral replication, making them attractive as therapeutic candidates and potential tools for dissecting viral pathogenesis. However, it is not well understood how aptamer-expression context and cellular RNA pathways govern aptamer accumulation and net antiviral bioactivity. Using a previously-described expression cassette in which aptamers were flanked by two "minimal core" hammerhead ribozymes, we observed only weak suppression of pseudotyped HIV. To evaluate the importance of the minimal ribozymes, we replaced them with extended, tertiary-stabilized hammerhead ribozymes with enhanced self-cleavage activity, in addition to noncleaving ribozymes with active site mutations. Both the active and inactive versions of the extended hammerhead ribozymes increased inhibition of pseudotyped virus, indicating that processing is not necessary for bioactivity. Clonal stable cell lines expressing aptamers from these modified constructs strongly suppressed infectious virus, and were more effective than minimal ribozymes at high viral multiplicity of infection (MOI). Tertiary stabilization greatly increased aptamer accumulation in viral and subcellular compartments, again regardless of self-cleavage capability. We therefore propose that the increased accumulation is responsible for increased suppression, that the bioactive form of the aptamer is one of the uncleaved or partially cleaved transcripts, and that tertiary stabilization increases transcript stability by reducing exonuclease degradation.

| S-EPMC3519987 | biostudies-literature

Peptide aptamers: development and applications.

Project description:Peptide aptamers are small combinatorial proteins that are selected to bind to specific sites on their target molecules. Peptide aptamers consist of short, 5-20 amino acid residues long sequences, typically embedded as a loop within a stable protein scaffold. Various peptide aptamer scaffolds and in vitro and in vivo selection techniques are reviewed with emphasis on specific biomedical, bioimaging, and bioanalytical applications.

| S-EPMC4428161 | biostudies-literature

High-density functional-RNA arrays as a versatile platform for studying RNA-based interactions.

Project description:We are just beginning to unravel the myriad of interactions in which non-coding RNAs participate. The intricate RNA interactome is the foundation of many biological processes, including bacterial virulence and human disease, and represents unexploited resources for the development of potential therapeutic interventions. However, identifying specific associations of a given RNA from the multitude of possible binding partners within the cell requires robust high-throughput systems for their rapid screening. Here, we present the first demonstration of functional-RNA arrays as a novel platform technology designed for the study of such interactions using immobilized, active RNAs. We have generated high-density RNA arrays by an innovative method involving surface-capture of in vitro transcribed RNAs. This approach has significant advantages over existing technologies, particularly in its versatility in regards to binding partner character. Indeed, proof-of-principle application of RNA arrays to both RNA-small molecule and RNA-RNA pairings is demonstrated, highlighting their potential as a platform technology for mapping RNA-based networks and for pharmaceutical screening. Furthermore, the simplicity of the method supports greater user-accessibility over currently available technologies. We anticipate that functional-RNA arrays will find broad utility in the expanding field of RNA characterization.

| S-EPMC6101487 | biostudies-literature

Self-assembling asymmetric peptide-dendrimer micelles - a platform for effective and versatile in vitro nucleic acid delivery.

Project description:Despite advancements in the development of high generation cationic-dendrimer systems for delivery of nucleic acid-based therapeutics, commercially available chemical agents suffer from major drawbacks such as cytotoxicity while being laborious and costly to synthesize. To overcome the aforementioned limitations, low-generation cationic peptide asymmetric dendrimers with side arm lipid (cholic and decanoic acid) conjugation were designed, synthesized and systematically screened for their ability to self-assemble into micelles using dynamic light scattering. Cytotoxicity profiling revealed that our entire asymmetric peptide dendrimer library when trialled alone, or as asymmetric dendrimer micelle-nucleic acid complexes, were non-cytotoxic across a broad concentration range. Further, the delivery efficiency of asymmetric peptide dendrimers in H-4-II-E (rat hepatoma), H2K (mdx mouse myoblast), and DAOY (human medulloblastoma) cells demonstrated that cholic acid-conjugated asymmetric dendrimers possess far superior delivery efficiency when compared to the commercial standards, Lipofectamine 2000 or Lipofectin®.

| S-EPMC5859181 | biostudies-literature

Development of an intracellularly acting inhibitory peptide selective for PKN.

Project description:PKNs form a subfamily of the AGC serine/threonine protein kinases, and have a catalytic domain homologous with that of PKC (protein kinase C) in the C-terminal region and three characteristic ACC (antiparallel coiled-coil) domain repeats in the N-terminal region. The preferred peptide phosphorylation motif for PKNs determined by a combinatorial peptide library method was highly similar to that of PKCs within a 10-amino-acid stretch. Previously reported PKN inhibitory compounds also inhibit PKCs to a similar extent, and no PKN selective inhibitors have been commercially available. We have identified a 15-amino-acid peptide inhibitor of PKNs based on amino acids 485-499 of the C-terminal region of the C2-like domain of PKN1. This peptide, designated as PRL, selectively inhibits the kinase activity of all isoforms of PKN (Ki=0.7 muM) towards a peptide substrate, as well as autophosphorylation activity of PKN in vitro, in contrast with PKC. Reversible conjugation by a disulfide bond of a carrier peptide bearing a penetration accelerating sequence to PRL, facilitated the cellular uptake of this peptide and significantly inhibited phosphorylation of tau by PKN1 at the PKN1-specific phosphorylation site in vivo. This peptide may serve as a valuable tool for investigating PKN activation and PKN-mediated responses.

| S-EPMC3755880 | biostudies-other

Methods for Evaluating Cell-Specific, Cell-Internalizing RNA Aptamers.

Project description:Recent clinical trials of small interfering RNAs (siRNAs) highlight the need for robust delivery technologies that will facilitate the successful application of these therapeutics to humans. Arguably, cell targeting by conjugation to cell-specific ligands provides a viable solution to this problem. Synthetic RNA ligands (aptamers) represent an emerging class of pharmaceuticals with great potential for targeted therapeutic applications. For targeted delivery of siRNAs with aptamers, the aptamer-siRNA conjugate must be taken up by cells and reach the cytoplasm. To this end, we have developed cell-based selection approaches to isolate aptamers that internalize upon binding to their cognate receptor on the cell surface. Here we describe methods to monitor for cellular uptake of aptamers. These include: (1) antibody amplification microscopy, (2) microplate-based fluorescence assay, (3) a quantitative and ultrasensitive internalization method ("QUSIM") and (4) a way to monitor for cytoplasmic delivery using the ribosome inactivating protein-based (RNA-RIP) assay. Collectively, these methods provide a toolset that can expedite the development of aptamer ligands to target and deliver therapeutic siRNAs in vivo.

| S-EPMC3722562 | biostudies-literature

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data