Transcriptome sequencing identified the ceRNA network associated with recurrent spontaneous abortion.
Ontology highlight
ABSTRACT: Background
Recurrent spontaneous abortion (RSA) is one of the common complication of pregnancy, bringing heavy burden to the patients and their families. The study aimed to explore the lncRNA-miRNA-mRNA network associated with recurrent spontaneous abortion.Methods
By transcriptome sequencing, we detected differences in lncRNA, miRNA and mRNA expression in villus tissue samples collected from 3 patients with RSA and 3 normal abortion patients. Differentially expressed lncRNAs, miRNAs and genes (DELs, DEMs and DEGs, respectively) were identified, and Geno Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were used to determine the functions of DELs and DEGs, which were analysed by Fisher's test. We also observed the regulatory relationships between miRNA-mRNA and lncRNA-miRNA by Cytoscape 3.6.1.Results
The results showed that 1008 DELs (523 upregulated and 485 downregulated), 475 DEGs (201 upregulated and 274 downregulated) and 37 DEMs (15 upregulated and 22 downregulated) were identified. And we also constructed a novel lncRNA-related ceRNA network containing 31 lncRNAs, 1 miRNA (hsa-miR-210-5p) and 3 genes (NTNG2, GRIA1 and AQP1).Conclusions
lncRNA-related ceRNA network containing 31 lncRNAs, 1 miRNA (hsa-miR-210-5p) and 3 mRNAs (NTNG2, GRIA1 and AQP1) was constructed. The results may provide a basic theory for elucidating the mechanism underlying RSA.
SUBMITTER: Huang Y
PROVIDER: S-EPMC8609870 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.
| S-EPMC10280933 | biostudies-literature
Project description:Identifying the mechanisms underlying unexplained recurrent spontaneous abortion (URSA) can help develop effective treatments. This study provides novel insights into the biological characteristics and related pathways of differentially expressed genes (DEGs) in URSA. Nineteen patients with URSA and three healthy fertile women with regular menstruation (control group) were recruited. RNA was extracted from the two groups to determine the differential expression of immunoregulatory gene sequences. Gene ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analyses were used to identify the biological functions and pathways of the identified DEGs. A protein-protein interaction (PPI) network was constructed using the STRING database. Furthermore, qRT-PCR and ELISA were performed to validate the differential expression of the hub genes. We also explored the regulatory mechanism of Th1/Th2 imbalance. A total of 99 DEGs were identified, comprising 94 upregulated and five downregulated genes. Through GO analysis, nine immune cell function-related clusters were selected, and genes with significant differential expression were primarily enriched in eight immune regulatory functions related to the KEGG signalling pathway. Subsequently, five hub genes (TLR2, CXCL8, IFNG, IL2RA, and ITGAX) were identified using Cytoscape software; qRT-PCR confirmed the differential expression among the hub genes, whereas ELISA revealed a significant difference in extracellular IFN-γ and IL-8 levels. The levels of Th1 (IFN-γ) and the Th1/Th2 ratio were higher in the peripheral blood of URSA patients than in control group patients. These findings suggest that the occurrence of URSA may be associated with the abnormal expression of some specific immunoregulatory genes involved in T-cell activation and differentiation. Among the identified DEGs, IFNG may play a key role in regulating maternal immune response. Although further validation is required, our data provide an important theoretical basis for elucidating the pathogenesis of recurrent spontaneous abortion.
| S-EPMC8375436 | biostudies-literature
Project description:ObjectivesSuccessful pregnancy involves the homeostasis between maternal decidua and fetoplacental units, whose disruption contributes to compromised pregnancy outcomes, including recurrent spontaneous abortion (RSA). The role of cell heterogeneity of maternal decidua in RSA is yet to be illustrated.Materials and methodsA total of 66,078 single cells from decidua samples isolated from patients with RSA and healthy controls were analysed by unbiased single-cell RNA sequencing (scRNA-seq).ResultsOur scRNA-seq results revealed that stromal cells are the most abundant cell type in decidua during early pregnancy. RSA samples are accompanied by aberrant decidualization and obviously obstructed communication between stromal cells and other cell types, such as abnormal activation of macrophages and NK cells. In addition, the over-activated TNF superfamily member 12 (TNFSF12, TWEAK) and FASLG in RSA are closely related to stromal cell demise and pregnancy failure.ConclusionsOur research reveals that the cell composition and communications in normal and RSA decidua at early pregnancy and provides insightful information for the pathology of RSA and will pave the way for pregnancy loss prevention.
| S-EPMC8560595 | biostudies-literature
Project description:The diagnosis and treatment of unexplained recurrent spontaneous abortion (URSA) are subject to debate, because the exact underlying mechanisms remain unclear. To address this issue, we elucidated the expression profiles of dysregulated circRNAs, miRNAs, and mRNAs and constructed circRNA-associated competitive endogenous RNA (ceRNA) networks by comparing the decidua of URSA with that of normal early pregnancy (NEP) using RNA-sequencing. In total, 550 mRNAs, 88 miRNAs, and 139 circRNAs were differentially expressed (DE) in decidua of URSA. Functional annotation revealed that DE mRNAs as well as potential target genes of DE miRNAs and DE circRNAs are mainly involved in immunologic function, such as antigen processing and presentation, allograft rejection, and T cell receptor signaling pathway. In addition, the top hub genes, including CCL4, DDX58, CXCL10, CXCL9, MX1, CD44, RPS2, SOCS3, RPS3A, and CXCL11, were identified. The mRNAs involved in ceRNA network were enriched in complement and coagulation cascades and protein processing in the endoplasmic reticulum. We found that circRNAs in the ceRNA network, which acted as decoys for hsa-miR-204-5p, were positively correlated with MFGE8 expression. Collectively, the results demonstrated that circRNAs, miRNAs, and mRNAs were aberrantly expressed in the decidua of patients with URSA and played a potential role in the development of URSA. Thus, the establishment of the ceRNA network may profoundly affect the diagnosis and therapy of URSA in the future.
| S-EPMC9194479 | biostudies-literature
Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.
| S-EPMC9201170 | biostudies-literature
Project description:Physiological studies in animals and human support an important role of circadian system in reproduction. The aim of this study was to investigate the potential association of CLOCK gene polymorphisms with idiopathic recurrent spontaneous abortion (IRSA). We performed a case-control study. The study group consisted of 268 women with a history of three or more idiopathic recurrent spontaneous abortions and 284 women with at least two live births and no history of pathologic pregnancies all from Slovenia and Serbia. Two SNPs in the CLOCK gene were chosen and genotyped. The results showed a statistically significant difference in genotype distribution between the two groups in the CLOCK gene for rs6850524 and rs11932595. Our analysis showed that G allele under dominant model (GG+GC/CC) for rs6850524 (p = 2?10-4, OR = 2.28, 95%CI = 1.46-3.56) as well as G allele under dominant model (GA+AA/AA) for rs11932595 (p = 0.04, OR = 1.47, 95%CI = 1.01-2.04) might be risk factors against IRSA. Our data suggest that genetic variability in the CLOCK gene is associated with IRSA warranting further confirmation and mechanistic investigations.
| S-EPMC5955485 | biostudies-literature
Project description:Purpose: The aim of this study was to conduct a comprehensive transcriptomic analysis to explore the potential biological functions of noncoding RNA (ncRNAs) in temporomandibular joint osteoarthritis (TMJOA). Methods: Whole transcriptome sequencing was performed to identify differentially expressed genes (DEGs) profiles between the TMJOA and normal groups. The functions and pathways of the DEGs were analyzed using Metascape, and a competitive endogenous RNA (ceRNA) network was constructed using Cytoscape software. Results: A total of 137 DEmRNAs, 65 DEmiRNAs, 132 DElncRNAs, and 29 DEcircRNAs were identified between the TMJOA and normal groups. Functional annotation of the DEmRNAs revealed that immune response and apoptosis are closely related to TMJOA and also suggested key signaling pathways related to TMJOA, including chronic depression and PPAR signaling pathways. We identified vital mRNAs, including Klrk1, Adipoq, Cryab, and Hspa1b. Notably, Adipoq expression in cartilage was significantly upregulated in TMJOA compared with normal groups (10-fold, p < 0.001). According to the functional analysis of DEmRNAs regulated by the ceRNA network, we found that ncRNAs are involved in the regulation of autophagy and apoptosis. In addition, significantly DEncRNAs (lncRNA-COX7A1, lncRNA-CHTOP, lncRNA-UFM1, ciRNA166 and circRNA1531) were verified, and among these, circRNA1531 (14.5-fold, p < 0.001) and lncRNA-CHTOP (14.8-fold, p < 0.001) were the most significantly downregulated ncRNAs. Conclusion: This study showed the potential of lncRNAs, circRNAs, miRNAs, and mRNAs may as clinical biomarkers and provides transcriptomic insights into their functional roles in TMJOA. This study identified the transcriptomic signatures of mRNAs associated with immunity and apoptosis and the signatures of ncRNAs associated with autophagy and apoptosis and provides insight into ncRNAs in TMJOA.
| S-EPMC9581126 | biostudies-literature
Project description:Our study found that low SDHB expression and high succinate levels are important for maintaining embryo implantation in the first trimester; therefore, high SDHB expression and low succinate levels during early pregnancy may increase the risk of RSA. To investigate why villous SDHB expression increases pathologically in RSA but exhibits dynamically low levels during the first trimester followed by high levels under physiological conditions, we detected CpG site methylation levels in the SDHB promoter region of villi from both individuals with RSA and controls.
2021-04-13 | GSE171877 | GEO
Project description:Normal pregnancy is related to the successful transition from type 1 cellular immunity to type 2 cellular immunity. Therefore, this study aimed to investigate whether there is abnormal expression of cytokines in the process of inducing Recurrent spontaneous abortion (RSA). Interleukin (IL)-33 is a new member of the IL-1 family, and ST2, as IL-33's receptor, induced the production of type 2 cytokines. In this study, blood samples were collected from 19 non-pregnant women of normal childbearing age, 28 normal pregnant women, and 33 women with RSA. The serum concentrations of IL-33 and ST2 were detected by flow cytometry. Our results showed that the serum concentrations of IL-33 and ST2 in the RSA group were significantly higher than those in the healthy control group (IL-33: P < 0.05; ST2: P < 0.0001), and IL-33 and ST2 had a higher level in the process of RSA predictive value. In addition, this study initially found that the serum concentrations of IL-33 and ST2 were not significantly correlated with the number of weeks of pregnancy, and there was a lower correlation between IL-33 and ST2 during RSA. This result may be related to the small number of cases. This study is the first time to correlate the changes in serum concentrations of IL-33 and ST2 with RSA, which may be a novel biomarker for the prediction and treatment of RSA.
| S-EPMC8793670 | biostudies-literature
Project description:ObjectivesTo explore the key genes involved in the occurrence and development of glioblastoma (GBM) by analyzing whole-transcriptome sequencing and biologic data from GBM and normal cerebral cortex tissues and to search for important noncoding RNA (ncRNA) molecular markers based on the competitive endogenous RNA (ceRNA) network.MethodsTen GBM and normal cerebral cortex tissues were collected for full transcriptome sequencing, screened for differentially expressed (DE) mRNAs, miRNAs, lncRNAs, and circRNAs, and subjected to bioinformatic analysis. We constructed a Protein-Protein Interaction (PPI) network and a circRNA/lncRNA-miRNA-mRNA regulatory network and identified them using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Finally, The Cancer Genome Atlas (TCGA) and Chinese Glioma Genome Atlas (CGGA) databases were used to validate and conduct a survival analysis of the target genes.ResultsA total of 5341 DEmRNAs, 259 DEmiRNAs, 3122 DElncRNAs, and 2135 DEcircRNAs were identified. Enrichment analysis showed that target genes regulated by DEmiRNA, DElncRNA, and DEcircRNA were closely related to chemical synaptic transmission and ion transmembrane transport. A PPI network analysis screened 10 hub genes that directly participate in tumor cell mitosis regulation. In addition, the ceRNA composite network showed that hsa-miR-296-5p and hsa-miR-874-5p were the central nodes of the network, and the reliability of relevant key molecules was successfully verified through RT-qPCR identification and the TCGA database. The CGGA database survival analysis produced 8 DEmRNAs closely related to GBM patient survival prognosis.ConclusionsThis study revealed the important regulatory functions and molecular mechanisms of ncRNA molecules and identified hsa-miR-296-5p and hsa-miR-874-5p as key molecules in the ceRNA network. They may play an important role in GBM pathogenesis, treatment, and prognosis.
| S-EPMC10331694 | biostudies-literature