Dataset Information

Genetic variation in the CLOCK gene is associated with idiopathic recurrent spontaneous abortion.

ABSTRACT: Physiological studies in animals and human support an important role of circadian system in reproduction. The aim of this study was to investigate the potential association of CLOCK gene polymorphisms with idiopathic recurrent spontaneous abortion (IRSA). We performed a case-control study. The study group consisted of 268 women with a history of three or more idiopathic recurrent spontaneous abortions and 284 women with at least two live births and no history of pathologic pregnancies all from Slovenia and Serbia. Two SNPs in the CLOCK gene were chosen and genotyped. The results showed a statistically significant difference in genotype distribution between the two groups in the CLOCK gene for rs6850524 and rs11932595. Our analysis showed that G allele under dominant model (GG+GC/CC) for rs6850524 (p = 2?10-4, OR = 2.28, 95%CI = 1.46-3.56) as well as G allele under dominant model (GA+AA/AA) for rs11932595 (p = 0.04, OR = 1.47, 95%CI = 1.01-2.04) might be risk factors against IRSA. Our data suggest that genetic variability in the CLOCK gene is associated with IRSA warranting further confirmation and mechanistic investigations.

SUBMITTER: Hodzic A

PROVIDER: S-EPMC5955485 | biostudies-literature | 2018

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Genetic variation in the CLOCK gene is associated with idiopathic recurrent spontaneous abortion.

Hodžić Alenka A Lavtar Polona P Ristanović Momčilo M Novaković Ivana I Dotlić Jelena J Peterlin Borut B

PloS one 20180516 5

Physiological studies in animals and human support an important role of circadian system in reproduction. The aim of this study was to investigate the potential association of CLOCK gene polymorphisms with idiopathic recurrent spontaneous abortion (IRSA). We performed a case-control study. The study group consisted of 268 women with a history of three or more idiopathic recurrent spontaneous abortions and 284 women with at least two live births and no history of pathologic pregnancies all from S ...[more]

PMID: 29768442

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Dataset Information

Genetic variation in the CLOCK gene is associated with idiopathic recurrent spontaneous abortion.

Publications

Genetic variation in the CLOCK gene is associated with idiopathic recurrent spontaneous abortion.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets