Dataset Information

Key Gene and Functional Pathways Identified in Unexplained Recurrent Spontaneous Abortion Using Targeted RNA Sequencing and Clinical Analysis.

ABSTRACT: Identifying the mechanisms underlying unexplained recurrent spontaneous abortion (URSA) can help develop effective treatments. This study provides novel insights into the biological characteristics and related pathways of differentially expressed genes (DEGs) in URSA. Nineteen patients with URSA and three healthy fertile women with regular menstruation (control group) were recruited. RNA was extracted from the two groups to determine the differential expression of immunoregulatory gene sequences. Gene ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analyses were used to identify the biological functions and pathways of the identified DEGs. A protein-protein interaction (PPI) network was constructed using the STRING database. Furthermore, qRT-PCR and ELISA were performed to validate the differential expression of the hub genes. We also explored the regulatory mechanism of Th1/Th2 imbalance. A total of 99 DEGs were identified, comprising 94 upregulated and five downregulated genes. Through GO analysis, nine immune cell function-related clusters were selected, and genes with significant differential expression were primarily enriched in eight immune regulatory functions related to the KEGG signalling pathway. Subsequently, five hub genes (TLR2, CXCL8, IFNG, IL2RA, and ITGAX) were identified using Cytoscape software; qRT-PCR confirmed the differential expression among the hub genes, whereas ELISA revealed a significant difference in extracellular IFN-γ and IL-8 levels. The levels of Th1 (IFN-γ) and the Th1/Th2 ratio were higher in the peripheral blood of URSA patients than in control group patients. These findings suggest that the occurrence of URSA may be associated with the abnormal expression of some specific immunoregulatory genes involved in T-cell activation and differentiation. Among the identified DEGs, IFNG may play a key role in regulating maternal immune response. Although further validation is required, our data provide an important theoretical basis for elucidating the pathogenesis of recurrent spontaneous abortion.

SUBMITTER: Gu H

PROVIDER: S-EPMC8375436 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Shared Molecules

Only show the datasets with similarity scores above: 0.5

Threshold

0.5

Similar Datasets

Project description:BackgroundThe precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA.MethodsGenomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA.ResultsIn 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup).ConclusionsThese pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Project description:BackgroundUnexplained recurrent spontaneous abortion (URSA) is one of the most challenging conditions frustrates women of childbearing age profoundly. The gene expression patterns and biological characteristics of placental villus in patients with URSA remain largely unknown. The aim of our study was to identify potential lncRNAs as well as their action mechanisms in URSA.MethodThe ceRNA microarray was used to identify the mRNA and lncRNA expression profiles of URSA patients and normal pregnancy. Functional enrichment analyses for differentially expressed mRNAs in URSA were performed. Protein-protein interaction analysis of differentially expressed mRNAs was performed to identify hub genes and key modules. Subsequently, the co-dysregulated ceRNA network of URSA was established, and the enrichment analyses for the mRNAs in the ceRNA network was implemented. qRT-PCR was performed to validated the expression of key ENST00000429019 and mRNAs in URSA.ResultsWe found that URSA placental villus have distinct mRNA and lncRNA expression profiles through ceRNA microarray, with a total of 347 mRNAs and 361 lncRNAs differentially expressed compared with controls. The functional enrichment analysis revealed that ncRNA processing, DNA replication, cell cycle, apoptosis, cytokine-mediated signaling pathway, ECM-receptor interaction were the potentially disrupted pathways in URSA patients. Then we constructed a co-dysregulated ceRNA network and found differentially expressed mRNAs were regulated by a small fraction of hub lncRNAs. Finally, we found a key network of ENST00000429019 and three cell proliferation or apoptosis related key mRNAs (CDCA3, KIFC1, NCAPH), and validated their expression and regulation in tissue and cellular levels.ConclusionsThis study identified a key ceRNA network, which might take part in URSA and correlate with cell proliferation and apoptosis. Optimistically, this study may deepen our apprehensions about the underlying molecular and biological causes of URSA and provide an important theoretical basis for future therapeutic strategies for patients with URSA.

Project description:BackgroundMaternally Expressed Gene 3 (MEG3) is expressed at low levels in placental villi during preeclampsia; however, its roles in unexplained recurrent spontaneous abortion (URSA) remain unclear. In this study, we aimed to explore the relationship between MEG3 and URSA.MethodsThe differentially expressed lncRNAs (MEG3) and its downstream genes (RASA1) were identified using bioinformatics analysis of Genomic Spatial Event (GSE) database. The expression levels of MEG3 in embryonic villis (with gestational ages of 49-63 days) and primary trophoblasts were determined using quantitative RT-PCR assay. A mouse model of Embryo implantation, Cell Counting Kit-8 (CCK-8), flow cytometry, and Transwell migration assays were performed to determine the implantation, proliferative, apoptotic, and invasive capacities of trophoblast. The level of phosphorylated core proteins in the RAS-MAPK pathway were analyzed using Western blot assay. The mechanisms of MEG3 in the regulation of RASA1 were studied by RNA pulldown, RNA immunoprecipitation (RIP), DNA pulldown, and chromatin immunoprecipitation (ChIP) assays.ResultsMEG3 had a low expression level in embryonic villis of 102 URSA patients compared with those of 102 normal pregnant women. MEG3 could promote proliferation and invasion, inhibit the apoptosis of primary trophoblast of URSA patients (PT-U cells), as well as promote embryo implantation of mouse. Besides, MEG3 also promoted the phosphorylation of rapidly accelerated fibrosarcoma (Raf), mitogen-activated protein kinase kinase (MEK), and extracellular-signal-regulated kinase (ERK) proteins. The results of RNA pull down and RIP assays showed that MEG3 bound with the enhancer of zeste homolog 2 (EZH2). The DNA pulldown assay revealed that MEG3 could bind to the promoter sequence of the RAS P21 Protein Activator 1 (RASA1) gene. Further, the ChIP assay showed that MEG3 promoted the binding of EZH2 to the promoter region of the RASA1 gene.ConclusionsThe inactivation of MEG3 in embryonic villi association with URSA; MEG3 inhibited the expression of RASA1 by mediating the histone methylation of the promoter of RASA1 gene by EZH2, thereby activating the RAS-MAPK pathway and enhancing the proliferative and invasive capacities of trophoblasts.