Browse
Submit Data
Databases
API
Help

Dataset Information

17 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Enhancement of the Immunostimulatory Effect of Phosphodiester CpG Oligodeoxynucleotides by an Antiparallel Guanine-Quadruplex Structural Scaffold.

ABSTRACT: Guanine-quadruplex-based CpG oligodeoxynucleotides (G4 CpG ODNs) have been developed as potent immunostimulatory agents with reduced sensitivity to nucleases. We designed new monomeric G4 ODNs with an antiparallel topology using antiparallel type duplex/G4 ODNs as robust scaffolds, and we characterized their topology and effects on cytokine secretion. Based on circular dichroism analysis and quantification of mRNA levels of immunostimulatory cytokines, it was found that monomeric antiparallel G4 CpG ODNs containing two CpG motifs in the first functional loop, named G2.0.0, could maintain antiparallel topology and generate a high level of immunostimulatory cytokines in RAW264 mouse macrophage-like cell lines. We also found that the flanking sequence in the CpG motif altered the immunostimulatory effects. Gc2c.0.0 and Ga2c.0.0 are monomeric antiparallel G4 CpG ODNs with one cytosine in the 3' terminal and one cytosine/adenine in the 5' terminal of CpG motifs that maintained the same resistance to degradation in serum as G2.0.0 and improved interleukin-6 production in RAW264 and bone marrow-derived macrophages. The immunostimulatory activity of antiparallel G4 CpG ODNs is superior to that of linear natural CpG ODNs. These results provide insights for the rational design of highly potent CpG ODNs using antiparallel G4 as a robust scaffold.

SUBMITTER: Safitri FA

PROVIDER: S-EPMC8615816 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Phosphodiester backbone of the CpG motif within immunostimulatory oligodeoxynucleotides augments activation of Toll-like receptor 9.

Project description:Toll-like receptor 9 (TLR9) stimulatory CpG-containing oligodeoxynucleotides (ODNs) with phosphorothioate backbones have successfully replaced the naturally occurring agonists of TLR9 in drug development due to their increased stability. Replacing the nonbridging oxygen with a sulfur atom in the phosphate linkage of ODNs has been accepted as having a minor impact on the chemical and physical properties of the agonists. Here, we report that the TLR9 binding site exhibits a strong bias in favor of a phosphodiester backbone over the phosphorothioate backbone of the CpG motif. Furthermore, we show that while single point mutations of W47, W96 and K690 within the TLR9 binding site retains full TLR9 activation by phosphodiester-based ODNs, activation by phosphorothioate-based ODNs is strongly impaired. The substitution of a phosphorothioate linkage for a phosphodiester linkage of just the CpG motif considerably improves the activation potency of a phosphorothioate-based oligonucleotide for human B-cells and plasmacytoid dendritic cells, as well as for mouse bone marrow-derived dendritic cells and macrophages. Our results highlight the functional significance of the phosphodiester linkage of a CpG dinucleotide for binding, which is important in designing improved immunostimulatory TLR9 agonists.

| S-EPMC5668283 | biostudies-literature

Structure-dependent immunostimulatory effect of CpG oligodeoxynucleotides and their delivery system.

Project description:Unmethylated cytosine-phosphate-guanosine (CpG) oligodeoxynucleotides (ODNs) are recognized by Toll-like receptor 9 (TLR9) found in antigen-presenting cells and B cells and can activate the immune system. Using CpG ODNs as an adjuvant has been found to be effective for treating infectious diseases, cancers, and allergies. Because natural ODNs with only a phosphodiester backbone are easily degraded by nuclease (deoxyribonuclease [DNase]) in serum, CpG ODNs with a phosphorothioate backbone have been studied for clinical application. CpG ODNs with a phosphorothioate backbone have raised concern regarding undesirable side effects; however, several CpG ODNs with only a phosphodiester backbone have been reported to be stable in serum and to show an immunostimulatory effect. In recent years, research has been conducted on delivery systems for CpG ODNs using nanoparticles (NPs). The advantages of NP-based delivery of CpG ODN include (1) it can protect CpG ODN from DNase, (2) it can retain CpG ODN inside the body for a long period of time, (3) it can improve the cellular uptake efficiency of CpG ODN, and (4) it can deliver CpG ODN to the target tissues. Because the target cells of CpG ODN are cells of the immune system and TLR9, the receptor of CpG ODN is localized in endolysosomes, CpG ODN delivery systems are required to have qualities different from other nucleic acid drugs such as antisense DNA and small interfering RNA. Studies until now have reported various NPs as carriers for CpG ODN delivery. This review presents DNase-resistant CpG ODNs with various structures and their immunostimulatory effects and also focuses on delivery systems of CpG ODNs that utilize NPs. Because CpG ODNs interact with TLR9 and activate both the innate and the adaptive immune system, the application of CpG ODNs for the treatment of cancers, infectious diseases, and allergies holds great promise.

| S-EPMC3356174 | biostudies-literature

Targeted Delivery of Immunostimulatory CpG Oligodeoxynucleotides to Antigen-Presenting Cells in Draining Lymph Nodes by Stearic Acid Modification and Nanostructurization.

Project description:Polypod-like structured nucleic acids (polypodnas), which are nanostructured DNAs, are useful for delivering cytosine-phosphate guanine oligodeoxynucleotides (CpG ODNs) to antigen-presenting cells (APCs) expressing Toll-like receptor 9 (TLR9) for immune stimulation. Lipid modification is another approach to deliver ODNs to lymph nodes, where TLR9-positive APCs are abundant, by binding to serum albumin. The combination of these two methods can be useful for delivering CpG ODNs to lymph nodes in vivo. In the present study, CpG1668, a phosphodiester-type CpG ODN, was modified with stearic acid (SA) to obtain SA-CpG1668. Tripodna, a polypodna with three pods, was selected as the nanostructured DNA. Tripodnas loaded with CpG1668 or SA-CpG1668 were obtained in high yields. SA-CpG1668/tripodna bound more efficiently to plasma proteins than CpG1668/tripodna and was more efficiently taken up by macrophage-like RAW264.7 cells than CpG1668/tripodna, whereas the levels of tumor necrosis factor-α released from the cells were comparable between the two. After subcutaneous injection into mice, SA-CpG1668/tripodna induced significantly higher interleukin (IL)-12 p40 production in the draining lymph nodes than SA-CpG1668 or CpG1668/tripodna, with reduced IL-6 levels in plasma. These results indicate that the combination of SA modification and nanostructurization is a useful approach for the targeted delivery of CpG ODNs to lymph nodes.

| S-EPMC8836026 | biostudies-literature

Structural transition from antiparallel to parallel G-quadruplex of d(G4T4G4) induced by Ca2+.

Project description:Guanine quadruplex (G-quadruplex) structures are formed by guanine-rich oligonucleotides. Because of their in vivo and in vitro importance, numerous studies have been demonstrated that the structure and stability of the G-quadruplex are dependent on the sequence of oligonucleotide and environmental conditions such as existing cations. Previously, we quantitatively investigated the divalent cation effects on the antiparallel G-quadruplex of d(G4T4G4), and found that Ca2+ induces a structural transition from the antiparallel to parallel G-quadruplex, and finally G-wire formation. In the present study, we report in detail the kinetic and thermodynamic analyses of the structural transition induced by Ca2+ using stopped-flow apparatus, circular dichroism, size-exclusion chromatography (SEC) and atomic force microscopy. The quantitative parameters showed that at least two Ca2+ ions were required for the transition. The kinetic parameters also indicated that d(G4T4G4) underwent the transition through multiple steps involving the Ca2+ binding, isomerization and oligomerization of d(G4T4G4). The parallel-stranded G-wire structure of d(G4T4G4), which is a well controlled alignment of numerous DNA strands with G-quartets, as the final product induced by Ca2+, was observed using SEC and atomic force microscopy. These results provide insight into the mechanism of the structural transition and G-wire formation and are useful for constructing a nanomaterial regulated by Ca2+.

| S-EPMC150229 | biostudies-literature

Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.

Project description:Single-stranded DNA overhangs at the ends of human telomeric repeats are capable of adopting four-stranded G-quadruplex structures, which could serve as potential anticancer targets. Out of the five reported intramolecular human telomeric G-quadruplex structures, four were formed in the presence of K(+) ions and only one in the presence of Na(+) ions, leading often to a perception that this structural polymorphism occurs exclusively in the presence of K(+) but not Na(+). Here we present the structure of a new antiparallel (2+2) G-quadruplex formed by a derivative of a 27-nt human telomeric sequence in Na(+) solution, which comprises a novel core arrangement distinct from the known topologies. This structure complements the previously elucidated basket-type human telomeric G-quadruplex to serve as reference structures in Na(+)-containing environment. These structures, together with the coexistence of other conformations in Na(+) solution as observed by nuclear magnetic resonance spectroscopy, establish the polymorphic nature of human telomeric repeats beyond the influence of K(+) ions.

| S-EPMC3905899 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

Triplex-quadruplex structural scaffold: a new binding structure of aptamer.

Project description:Apart from the canonical Watson-Crick duplex, nucleic acids can often form other structures, e.g. G-quadruplex and triplex. These structures give nucleic acid additional functions besides coding for genetic information. Aptamers are one type of functional nucleic acids that bind to specific targets with high selectivity and affinity by folding into special tertiary structures. Despite the fact that numerous aptamers have been reported, only a few different types of aptamer structures are identified. Here we report a novel triplex-quadruplex hybrid scaffold formed by a codeine binding aptamer (CBA). CBA and its derivatives are G-rich DNA sequences. Codeine binding can induce the formation of a complex structure for this aptamer containing a G-quadruplex and a G·GC triplex, while codeine is located at the junction of the triplex and quadruplex. When split CBA into two moieties, codeine does not bind either moieties individually, but can bind them together by inducing the formation of the triplex-quadruplex scaffold. This structure formation induced by codeine binding is shown to inhibit polymerase reaction, which shows a potential application of the aptamer sequence in gene regulations.

| S-EPMC5684193 | biostudies-literature

Bimodular Antiparallel G-Quadruplex Nanoconstruct with Antiproliferative Activity.

Project description:Oligonucleotides with an antiproliferative activity for human cancer cells have attracted attention over the past decades; many of them have a G-quadruplex structure (GQ), and a cryptic target. In particular, DNA oligonucleotide HD1, a minimal GQ, could inhibit proliferation of some cancer cell lines. The HD1 is a 15-nucleotide DNA oligonucleotide that folds into a minimal chair-like monomolecular antiparallel GQ structure. In this study, for eight human cancer cell lines, we have analyzed the antiproliferative activities of minimal bimodular DNA oligonucleotide, biHD1, which has two HD1 modules covalently linked via single T-nucleotide residue. Oligonucleotide biHD1 exhibits a dose-dependent antiproliferative activity for lung cancer cell line RL-67 and cell line of central nervous system cancer U87 by MTT-test and Ki-67 immunoassay. The study of derivatives of biHD1 for the RL-67 and U87 cell lines revealed a structure-activity correlation of GQ folding and antiproliferative activity. Therefore, a covalent joining of two putative GQ modules within biHD1 molecule provides the antiproliferative activity of initial HD1, opening a possibility to design further GQ multimodular nanoconstructs with antiproliferative activity-either as themselves or as carriers.

| S-EPMC6803823 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

A Chimeric DNA/RNA Antiparallel Quadruplex with Improved Stability.

Project description:Nucleic acid quadruplexes are proposed to play a role in the regulation of gene expression, are often present in aptamers selected for specific binding functions and have potential applications in medicine and biotechnology. Therefore, understanding their structure and thermodynamic properties and designing highly stable quadruplexes is desirable for a variety of applications. Here, we evaluate DNA→RNA substitutions in the context of a monomolecular, antiparallel quadruplex, the thrombin-binding aptamer (TBA, GGTTGGTGTGGTTGG) in the presence of either K+ or Sr2+ . TBA predominantly folds into a chair-type configuration containing two G-tetrads, with G residues in both syn and anti conformation. All chimeras with DNA→RNA substitutions (G→g) at G residues requiring the syn conformation demonstrated strong destabilization. In contrast, G→g substitutions at Gs with anti conformation increased stability without affecting the monomolecular chair-type topology. None of the DNA→RNA substitutions in loop positions affected the quadruplex topology; however, these substitutions varied widely in their stabilizing or destabilizing effects in an unpredictable manner. This analysis allowed us to design a chimeric DNA/RNA TBA construct that demonstrated substantially improved stability relative to the all-DNA construct. These results have implications for a variety of quadruplex-based applications including for the design of dynamic nanomachines.

| S-EPMC8805387 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data