Browse
Submit Data
Databases
API
Help

Dataset Information

7 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Circular RNA mediated gene regulation in chronic diabetic complications.

ABSTRACT: Chronic diabetic complications affect multiple organs causing widespread organ damage. Although there are some commonalities, the phenotype of such changes show tissue specific variation. Given this, we examined whether differences in circular RNA (circRNA) mediated gene regulatory mechanisms contribute to changes in gene expression at the basal level and in diabetes. CircRNAs are single-stranded RNA with covalently closed loop structures and act as miRNA sponges, factors of RNA splicing, scaffolding for proteins, regulators of transcription, and modulators of the expression of parental genes, among other roles. We examined heart and retinal tissue from Streptozotocin-induced diabetic mice with established diabetes related tissue damage and tissue from non-diabetic controls. A custom array analysis was performed and the data were analysed. Two major circRNA mediated processes were uniquely upregulated in diabetic heart tissue, namely, positive regulation of endothelial cell migration and regulation of mitochondria: mitochondrial electron transport. In the retina, circRNAs regulating extracellular matrix protein production and endothelial to mesenchymal transition (EndMT) were found to be upregulated. The current study identified regulatory and potential pathogenetic roles of specific circRNA in diabetic retinopathy and cardiomyopathy. Understanding such novel mechanisms, may in the future, be useful to develop RNA based treatment strategies.

SUBMITTER: Patil NS

PROVIDER: S-EPMC8660871 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Circular RNA mediated gene regulation in human breast cancer: A bioinformatics analysis.

Project description:Circular RNAs (circRNAs) are a new acknowledged class of RNAs that has been shown to play a major role in several biological functions both in physiological and pathological conditions, operating as critical part of regulatory processes, like competing endogenous RNA (ceRNA) networks. The ceRNA hypothesis is a recently discovered molecular mechanism that adds a new key layer of post-transcriptional regulation, whereby various types of RNAs can reciprocally influence each other's expression competing for binding the same pool of microRNAs, even affecting disease development. In this study, we build a network of circRNA-miRNA-mRNA interactions in human breast cancer, called CERNOMA, that is a bipartite graph with one class of nodes corresponding to differentially expressed miRNAs (DEMs) and the other one corresponding to differentially expressed circRNAs (DEC) and mRNAs (DEGs). A link between a DEC (or DEG) and DEM is placed if it is predicted to be a target of the DEM and shows an opposite expression level trend with respect to the DEM. Within the CERNOMA, we highlighted an interesting deregulated circRNA-miRNA-mRNA triplet, including the up-regulated hsa_circRNA_102908 (BRCA1 associated RING domain 1), the down-regulated miR-410-3p, and the up-regulated ESM1, whose overexpression has been already shown to promote tumor dissemination and metastasis in breast cancer.

| S-EPMC10370684 | biostudies-literature

Circular RNAs and the regulation of gene expression in diabetic nephropathy (Review).

Project description:Circular RNAs (circRNAs) are non‑coding single‑stranded covalently closed RNA molecules that are considered important as regulators of gene expression at the transcriptional and post‑transcriptional levels. These molecules have been implicated in the initiation and progression of multiple human diseases, ranging from cancer to inflammatory and metabolic diseases, including diabetes mellitus and its vascular complications. The present article aimed to review the current knowledge on the biogenesis and functions of circRNAs, as well as their role in cell processes associated with diabetic nephropathy. In addition, novel potential interactions between circRNAs expressed in renal cells exposed to high‑glucose concentrations and the transcription factors c‑Jun and c‑Fos are reported.

| S-EPMC10998718 | biostudies-literature

Circular RNA Regulation of Myogenesis.

Project description:Circular RNA (circRNA) is a novel class of non-coding RNA generated by pre-mRNA back splicing, which is characterized by a closed-loop structure. Although circRNAs were firstly reported decades ago, their regulatory roles have not been discovered until recently. In this review, we discussed the putative biogenesis pathways and regulatory functions of circRNAs. Recent studies showed that circRNAs are abundant in skeletal muscle tissue, and their expression levels are regulated during muscle development and aging. We, thus, characterized the expression profile of circRNAs in skeletal muscle and discussed regulatory functions and mechanism-of-action of specific circRNAs in myogenesis. The future investigation into the roles of circRNAs in both physiological and pathological conditions may provide novel insights in skeletal muscle development and provide new therapeutic strategies for muscular diseases.

| S-EPMC6721685 | biostudies-literature

RNA-mediated epigenetic regulation of gene expression.

Project description:Diverse classes of RNA, ranging from small to long non-coding RNAs, have emerged as key regulators of gene expression, genome stability and defence against foreign genetic elements. Small RNAs modify chromatin structure and silence transcription by guiding Argonaute-containing complexes to complementary nascent RNA scaffolds and then mediating the recruitment of histone and DNA methyltransferases. In addition, recent advances suggest that chromatin-associated long non-coding RNA scaffolds also recruit chromatin-modifying complexes independently of small RNAs. These co-transcriptional silencing mechanisms form powerful RNA surveillance systems that detect and silence inappropriate transcription events, and provide a memory of these events via self-reinforcing epigenetic loops.

| S-EPMC4376354 | biostudies-literature

RNA-mediated gene regulation is less evolvable than transcriptional regulation.

Project description:Much of gene regulation is carried out by proteins that bind DNA or RNA molecules at specific sequences. One class of such proteins is transcription factors, which bind short DNA sequences to regulate transcription. Another class is RNA binding proteins, which bind short RNA sequences to regulate RNA maturation, transport, and stability. Here, we study the robustness and evolvability of these regulatory mechanisms. To this end, we use experimental binding data from 172 human and fruit fly transcription factors and RNA binding proteins as well as human polymorphism data to study the evolution of binding sites in vivo. We find little difference between the robustness of regulatory protein-RNA interactions and transcription factor-DNA interactions to DNA mutations. In contrast, we find that RNA-mediated regulation is less evolvable than transcriptional regulation, because mutations are less likely to create interactions of an RNA molecule with a new RNA binding protein than they are to create interactions of a gene regulatory region with a new transcription factor. Our observations are consistent with the high level of conservation observed for interactions between RNA binding proteins and their target molecules as well as the evolutionary plasticity of regulatory regions bound by transcription factors. They may help explain why transcriptional regulation is implicated in many more evolutionary adaptations and innovations than RNA-mediated gene regulation.

| S-EPMC5899451 | biostudies-literature

Circular RNA expression profile in transgenic diabetic mouse kidneys.

Project description:BackgroundDiabetic nephropathy is one of the most important complications in patients with diabetes. The etiology and pathogenesis of diabetic nephropathy remain unclear. Several studies have indicated that circular RNAs (circRNAs) play crucial regulatory roles in numerous human diseases and normal physiology; however, to date, no study has focused on the comprehensive expression profile of circRNAs in the kidneys of diabetic mice. Therefore, we aimed to identify differentially expressed circRNAs in diabetic mouse kidneys to explore the possible roles of dysregulated circRNAs in diabetic nephropathy development.ResultsDiabetic BKS-Leprem2Cd479/Nju (BKS-DB/Nju) mice and their nondiabetic wild-type littermates of C57BL/KsJ wild-type (WT) mice were used as experimental animals. Among all circRNAs identified by high-throughput RNA sequencing, four circRNAs were upregulated and ten were downregulated in diabetic mouse kidneys compared to those in nondiabetic mouse kidneys. After verification using quantitative reverse transcriptase polymerase chain reaction assays, we found that circR_1084, circR_182, circR_4, circR_50, circR_596, circR_897, and circR_203 were downregulated, whereas circR_627, circR_628, circR_735, and circR_801 were upregulated in the renal tissues of 8- and 16-week-old BKS-DB/Nju mice compared to those in WT mice.ConclusionWe studied the circRNA expression profile in the kidneys of diabetic mice. Differentially expressed circRNAs may be useful as candidate biomarkers for diabetic nephropathy. Collectively, our results provide a novel theoretical basis for further investigation of the regulatory roles of circRNA in the etiology and pathogenesis of diabetic nephropathy.

| S-EPMC8182942 | biostudies-literature

miRNA-dependent gene silencing involving Ago2-mediated cleavage of a circular antisense RNA.

Project description:MicroRNAs (miRNAs) are ?22 nt non-coding RNAs that typically bind to the 3' UTR of target mRNAs in the cytoplasm, resulting in mRNA destabilization and translational repression. Here, we report that miRNAs can also regulate gene expression by targeting non-coding antisense transcripts in human cells. Specifically, we show that miR-671 directs cleavage of a circular antisense transcript of the Cerebellar Degeneration-Related protein 1 (CDR1) locus in an Ago2-slicer-dependent manner. The resulting downregulation of circular antisense has a concomitant decrease in CDR1 mRNA levels, independently of heterochromatin formation. This study provides the first evidence for non-coding antisense transcripts as functional miRNA targets, and a novel regulatory mechanism involving a positive correlation between mRNA and antisense circular RNA levels.

| S-EPMC3230379 | biostudies-literature

Circular RNA in cancer development and immune regulation.

Project description:Circular RNAs (circRNAs) are a class of single-stranded RNAs with closed loop structures formed by covalent bonds of head and tail. Exploration of circRNAs is continually increasing; however, their functional relevance largely remains to be elucidated. In general, they are stable, abundant, conserved and expressed in tissue-specific manner. These distinct properties and their diverse cellular actions indicate that circRNAs modulate transcription and translation, and may even function as translation templates. Growing evidence reveals that circRNAs contribute to various physiological and pathological processes, including the initiation and progression of cancer. In this review, we present the current knowledge about circRNAs in cancer development, as well as their potential for use as biomarkers and even therapeutic targets. CircRNA's role in immune regulation and antitumour immunotherapy is also discussed. In addition, possible challenges in antitumour therapy are raised, and current progress and future perspectives are provided.

| S-EPMC8918416 | biostudies-literature

Circular RNA circNOL10 Inhibits Lung Cancer Development by Promoting SCLM1-Mediated Transcriptional Regulation of the Humanin Polypeptide Family.

Project description:circNOL10 is a circular RNA expressed at low levels in lung cancer, though its functions in lung cancer remain unknown. Here, the function and molecular mechanism of circNOL10 in lung cancer development are investigated using in vitro and in vivo studies, and it is shown that circNOL10 significantly inhibits the development of lung cancer and that circNOL10 expression is co-regulated by methylation of its parental gene Pre-NOL10 and by splicing factor epithelial splicing regulatory protein 1 (ESRP1). circNOL10 promotes the expression of transcription factor sex comb on midleg-like 1 (SCML1) by inhibiting transcription factor ubiquitination and thus also affects regulation of the humanin (HN) polypeptide family by SCML1. circNOL10 also affects mitochondrial function through regulating the humanin polypeptide family and affecting multiple signaling pathways, ultimately inhibiting cell proliferation and cell cycle progression, and promoting the apoptosis of lung cancer cells, thereby inhibiting lung cancer development. This study investigates the functions and molecular mechanisms of circNOL10 in the development of lung cancer and reveals its involvement in the transcriptional regulation of the HN polypeptide family by SCML1. The results also demonstrate the inhibitory effect of HN on lung cancer cells growth. These findings may identify novel targets for the molecular therapy of lung cancer.

| S-EPMC6343086 | biostudies-literature

Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19.

Project description:COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.

| S-EPMC8282474 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data