Prospects of Biosensors Based on Functionalized and Nanostructured Solitary Materials: Detection of Viral Infections and Other Risks.
Ontology highlight
ABSTRACT:
SUBMITTER: Kumar S
PROVIDER: S-EPMC9260923 | biostudies-literature |
REPOSITORIES: biostudies-literature
Similar Datasets
Project description:We experimentally demonstrate an ultra-sensitive immunoassay biosensor using diatom biosilica with self-assembled plasmonic nanoparticles. As the nature-created photonic crystal structures, diatoms have been adopted to enhance surface plasmon resonances of metal nanoparticles on the surfaces of diatom frustules and to increase the sensitivity of surface-enhanced Raman scattering (SERS). In this study, a sandwich SERS immunoassay is developed based on the hybrid plasmonic-biosilica nanostructured materials that are functionalized with goat anti-mouse IgG. Our experimental results show that diatom frustules improve the detection limit of mouse IgG to 10 pg/mL, which is ˜100× better than conventional colloidal SERS sensors on flat glass. Ultra-sensitive immunoassay biosensor using diatom biosilica with self-assembled plasmonic nanoparticles.
| S-EPMC4758816 | biostudies-literature
Project description:Recent and potential applications of electrochromic materials include smart windows, optoelectronic devices, and energy conversion. In this study, we have incorporated bis(terpyridine) iron (II) complexes into vertically-oriented silica thin films deposited on indium-tin oxide (ITO) and their electrochromic behavior has been investigated. If 2,2':6',2″-terpyridine is commonly used as a ligand for forming metallo-supramolecular assemblies, with the objective to get metal-terpyridine complexes with multiple stable redox states, their simple and reliable arrangement into linear structures enabling effective electronic communication is however more challenging. We propose to overcome this difficulty by generating such complexes within vertical nanochannels on electrode. Terpyridine ligands were firstly immobilized by combining a click chemistry azide/alkyne approach with an electrochemically-assisted self-assembly (EASA) method used to grow an oriented mesoporous silica membrane bearing azide groups which were further derivatized with 4'-ethynyl-terpyridine ligands. The resulting terpyridine-functionalized films were consecutively dipped in an aqueous solution of Fe(BF4)2 and then in a solution of terpyridine in acetonitrile to form the bis(terpyridine) iron (II) complexes in situ. The electrochromic properties of the films functionalized at various levels were examined by monitoring the changes in their UV/Vis spectra upon electrochemical oxidation at controlled potential of +1.2 V vs. Ag/AgCl. Due to facile charge delocalization during the Fe2+ to Fe3+ redox process, the bis(terpyridine) iron (II) functionalized silica films exhibited electrochromic properties by changing from violet to non-colored using TBABF4 in acetonitrile as an electrolyte. The bis(terpyridine) iron(II) film experienced reversible electrochromic switching by applying +0.5 V in a reverse reduction electrochemical process. The Fe(tpy)2-functionalized silica thin films displayed a good contrast ratio (ΔT%) of 47% and relatively high coloration efficiency (CE) of about 245 cm2/C with a response time of coloring and bleaching of a few seconds (< 4 s).
| S-EPMC7523427 | biostudies-literature
Project description:Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.
| S-EPMC2867084 | biostudies-literature
Project description:Aflatoxins (AF) are naturally occurring mycotoxins, produced by many species of Aspergillus. Among aflatoxins, Aflatoxin M1 (AFM1) is one of the most frequent and dangerous for human health. The acceptable maximum level of AFM1 in milk according to EU regulation is 50 ppt, equivalent to 152 pM, and 25 ppt, equivalent to 76 pM, for adults and infants, respectively. Here, we study a photonic biosensor based on Si 3 N 4 asymmetric Mach-Zehnder Interferometers (aMZI) functionalized with Fab' for AFM1 detection in milk samples (eluates). The minimum concentration of AFM1 detected by our aMZI sensors is 48 pM (16.8 pg/mL) in purified and concentrated milk samples. Moreover, the real-time detection of the ligand-analyte binding enables the study of the kinetics of the reaction. We measured the kinetic rate constants of the Fab'-AFM1 interaction.
| S-EPMC6669449 | biostudies-literature
Project description:Purpose of reviewWe reviewed the current data on infections associated with rituximab use published over the last 5 years.Recent findingsNew literature was available on rates of serious infections, Hepatitis B reactivation and screening, and infection with Severe Acute Respiratory Syndrome Coronavirus 2. Rates of infection varied by study and population, however, higher risk of infection in patients with underlying rheumatologic diseases was seen in those who required a therapy switch, had a smoking history, and those undergoing retreatment who had a serious infection with their first course of therapy. With regards to HBV, the proportion of patients screened continues to be inadequate. Despite the upfront cost, HBV screening and prophylaxis were found to be cost effective. There is still limited data regarding COVID-19 severity in the setting of rituximab, however, rituximab, especially in combination with steroids, may lead to more severe disease and higher mortality.
| S-EPMC8284038 | biostudies-literature
Project description:A series of cytotoxic titanocene derivatives have been immobilized onto nanostructured silica-based materials using two different synthetic routes, namely, (i) a simple grafting protocol via protonolysis of the Ti-Cl bond; and (ii) a tethering method by elimination of ethanol using triethoxysilyl moieties of thiolato ligands attached to titanium. The resulting nanostructured systems have been characterized by different techniques such as XRD, XRF, DR-UV, BET, SEM, and TEM, observing the incorporation of the titanocene derivatives onto the nanostructured silica and slight changes in the textural features of the materials after functionalization with the metallodrugs. A complete biological study has been carried out using the synthesized materials exhibiting moderate cytotoxicity in vitro against three human hepatic carcinoma (HepG2, SK-Hep-1, Hep3B) and three human colon carcinomas (DLD-1, HT-29, COLO320) and very low cytotoxicity against normal cell lines. In addition, the cells' metabolic activity was modified by a 24-h exposure in a dose-dependent manner. Despite not having a significant effect on TNFα or the proinflammatory interleukin 1α secretion, the materials strongly modulated tumor necrosis factor (TNF) signaling, even at sub-cytotoxic concentrations. This is achieved mainly by upregulation of the TNFR1 receptor production, something which has not previously been observed for these systems.
| S-EPMC5848921 | biostudies-literature
Project description:This paper review current trends in applications of nanomaterials in tissue engineering. Nanomaterials applicable in this area can be divided into two groups: organic and inorganic. Organic nanomaterials are especially used for the preparation of highly porous scaffolds for cell cultivation and are represented by polymeric nanofibers. Inorganic nanomaterials are implemented as they stand or dispersed in matrices promoting their functional properties while preserving high level of biocompatibility. They are used in various forms (e.g., nano- particles, -tubes and -fibers)-and when forming the composites with organic matrices-are able to enhance many resulting properties (biologic, mechanical, electrical and/or antibacterial). For this reason, this contribution points especially to such type of composite nanomaterials. Basic information on classification, properties and application potential of single nanostructures, as well as complex scaffolds suitable for 3D tissues reconstruction is provided. Examples of practical usage of these structures are demonstrated on cartilage, bone, neural, cardiac and skin tissue regeneration and replacements. Nanomaterials open up new ways of treatments in almost all areas of current tissue regeneration, especially in tissue support or cell proliferation and growth. They significantly promote tissue rebuilding by direct replacement of damaged tissues.
| S-EPMC7178059 | biostudies-literature
Project description:Over the last years, optical biosensors based on plasmonic nanomaterials have gained great scientific interest due to their unquestionable advantages compared to other biosensing technologies. They can achieve sensitive, direct, and label-free analysis with exceptional potential for multiplexing and miniaturization. Recently, it has been demonstrated the potential of using optical discs as high throughput nanotemplates for the development of plasmonic biosensors in a cost-effective way. This work is a pilot study focused on the development of an integrated plasmonic biosensor for the monitoring of cell adhesion and growth of human retinal pigmented cell line (ARPE-19) under different media conditions (0 and 2% of FBS). We observed an increase of the plasmonic band displacement under 2% FBS compared to 0% conditions over time (1, 3, and 5 h). These preliminary results show that the proposed plasmonic biosensing approach is a direct, non-destructive, and real-time tool that could be employed in the study of living cells behavior and culture conditions. Furthermore, this setup could assess the viability of the cells and their growth over time with low variability between the technical replicates improving the experimental replicability.
| S-EPMC8685410 | biostudies-literature
Project description:The presentation of biologically active molecules at interfaces has made it possible to investigate the responses of cells to individual molecules in their matrix at a given density and spacing. However, more sophisticated methods are needed to create model surfaces that present more than one molecule in a controlled manner in order to mimic at least partially the complexity given in natural environments. Herein, we present dual-functionalized surfaces combining quasi-hexagonally arranged gold nanoparticles with defined spacings and a newly developed PEG-alkyne coating to functionalize the glass in the intermediate space. The PEG-alkyne coating provides an inert background for cell interactions but can be modified orthogonally to the gold nanoparticles with numerous azides, including spectroscopically active molecules, peptides, and biotin at controlled densities by the copper(I)-catalyzed azide alkyne click reaction. The simultaneous presentation of cRGD on the gold nanoparticles with 100 nm spacing and synergy peptide PHSRN in the space between has a striking effect on REF cell adhesion; cells adhere, spread, and form mature focal adhesions on the dual-functionalized surfaces, whereas cells cannot adhere on either monofunctional surface. Combining these orthogonal functionalization methods creates a new platform to study precisely the crosstalk and synergy between different signaling molecules and clustering effects in ligand-receptor interactions.
| S-EPMC4062568 | biostudies-literature
Project description:Necessitated by the subzero temperatures and seasonal exposure to ice, various organisms have developed a remarkably effective means to survive the harsh climate of their natural habitats. Their ice-binding (glyco)proteins keep the nucleation and growth of ice crystals in check by recognizing and binding to specific ice crystal faces, which arrests further ice growth and inhibits ice recrystallization (IRI). Inspired by the success of this adaptive strategy, various approaches have been proposed over the past decades to engineer materials that harness these cryoprotective features. In this review we discuss the prospects and challenges associated with these advances focusing in particular on peptidic antifreeze materials both identical and akin to natural ice-binding proteins (IBPs). We address the latest advances in their design, synthesis, characterization and application in preservation of biologics and foods. Particular attention is devoted to insights in structure-activity relations culminating in the synthesis of de novo peptide analogues. These are sequences that resemble but are not identical to naturally occurring IBPs. We also draw attention to impactful developments in solid-phase peptide synthesis and 'greener' synthesis routes, which may aid to overcome one of the major bottlenecks in the translation of this technology: unavailability of large quantities of low-cost antifreeze materials with excellent IRI activity at (sub)micromolar concentrations.
| S-EPMC6834126 | biostudies-literature