Physiology of rat-liver polysomes. Protein synthesis by stable polysomes.
Ontology highlight
ABSTRACT:
SUBMITTER: Wilson SH
PROVIDER: S-EPMC1270443 | biostudies-other | 1967 May
REPOSITORIES: biostudies-other
Similar Datasets
Project description:Starvation of rats for several days led to marked decrease in cytoplasmic polysomes and accumulation of breakdown products having S values less than 200s. Re-feeding of the starved animals induced a rapid reassembly of polysomes. These newly formed polysomes, in the presence of actinomycin D, decayed in a biphasic fashion: about two-thirds decayed with an apparent half-life of 3-3(1/2)hr. but the other one-third were much more stable. Evidence that polysome decay is an accurate reflexion of messenger RNA stability is presented, and it is concluded that in the presence of large doses of actinomycin D, rat-liver cytoplasm contains messenger RNA classes of widely varying stability, the more stable class having a half-life of at least 80hr. The half-life of liver ribosomes was also determined and was found to be 110-127hr.
| S-EPMC1270442 | biostudies-other
Project description:Structural studies of translating ribosomes traditionally rely on in vitro assembly and stalling of ribosomes in defined states. To comprehensively visualize bacterial translation, we reactivated ex vivo-derived E. coli polysomes in the PURE in vitro translation system and analyzed the actively elongating polysomes by cryo-EM. We find that 31% of 70S ribosomes assemble into disome complexes that represent eight distinct functional states including decoding and termination intermediates, and a pre-nucleophilic attack state. The functional diversity of disome complexes together with RNase digest experiments suggests that paused disome complexes transiently form during ongoing elongation. Structural analysis revealed five disome interfaces between leading and queueing ribosomes that undergo rearrangements as the leading ribosome traverses through the elongation cycle. Our findings reveal at the molecular level how bL9's CTD obstructs the factor binding site of queueing ribosomes to thwart harmful collisions and illustrate how translation dynamics reshape inter-ribosomal contacts.
| S-EPMC10897467 | biostudies-literature
Project description:1. The activities of microsome fractions from the liver of adult and 5-day-old rats for the incorporation of [(14)C]phenylalanine into protein were similar in the presence and absence of polyuridylic acid. 2. The activity of a light-microsome fraction from adult liver was greater than that of a heavy-microsome fraction, and the light-microsome fraction was also more markedly stimulated by the presence of polyuridylic acid. 3. The light-microsome fraction, when analysed by density-gradient centrifugation, contained a higher ratio of free ribosomes to bound ribosomes, whereas the reverse was true for the heavy-microsome fraction. Similar results were obtained for liver from adult and 5-day-old rats. 4. When the light-microsome fraction was incubated under conditions in which amino acid was incorporated into protein there was only a small increase in the ratio of free to bound ribosomes. When such a fraction was incubated with [(14)C]leucine and was then subjected to density-gradient centrifugation the fraction with the highest specific activity based on RNA had a density between that of the bound and free ribosomes. Treatment of the incubated fraction with ribonuclease shifted the radioactivity towards the free ribosome peak. These properties are consistent with the presence of active free polysomes. Such a component appeared also to be present when the heavy-microsome fraction was incubated under similar conditions. 5. The effect of the presence of polyuridylic acid on the incorporation of [(14)C]phenylalanine by the light-microsome fractions from liver of adult and 5-day-old rats was greatest in the region of the free ribosomes, but it is probable that some small polysomes containing polyuridylic acid are formed. 6. Polyuridylic acid also stimulated the bound ribosomes to a small extent when the heavy-microsome fraction from the liver of young rats was incubated with [(14)C]phenylalanine. 7. The results are discussed in terms of the various morphological constituents in liver now known to play a role in the synthesis of protein for export and for the internal activity of the cell.
| S-EPMC1264657 | biostudies-other
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:1. Washed microsome particles from regenerating liver were shown to incorporate [(14)C]leucine into protein more actively than similar preparations from normal liver. 2. The total incorporation in the preparations from regenerating liver increased linearly with the amount of protein incubated, whereas this was not so with preparations from normal liver. 3. The greater activity of regenerating-liver microsomes appeared to be associated with the bound polysomes. 4. The size distribution of polysomes obtained after removal of membrane with deoxycholate was the same in normal and regenerating liver. 5. In general the activity of polysome preparations from normal and regenerating liver was similar. 6. It is concluded that the greater activity of the particles in the microsome fraction from regenerating liver is to be attributed to the ribosomes bound to membrane and that their activity is controlled by factors present in the membrane.
| S-EPMC1270398 | biostudies-other
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:1. Treatment of rat liver polysomes in a buffer containing 2.5mm-magnesium chloride with T(1) ribonuclease at a concentration of 330units/ml. of reaction medium at 37 degrees for 2hr. leads to the production of an insoluble nucleoprotein. 2. On the bases of analysis for protein and RNA and of u.v.-absorption spectra the nucleoprotein appears to have lost approx. 60% of the structural RNA originally present in the ribosome. Degradation of (3)H-labelled polysomes (structural RNA labelled with orotic acid) with T(1) ribonuclease leads to nucleoprotein preparations retaining approx. 30% of the radioactivity originally present in the polysomes. By means of sucrose-density-gradient centrifugation it is shown that the nucleoprotein preparations are free of single 73s ribosomes and ribosomal subunits. No evidence for the presence of 28s and 18s structural RNA was obtained on examination of extracted nucleoprotein-particle RNA by means of sucrose-density-gradient centrifugation. 3. Digestion of washed polysomes carrying (14)C-labelled nascent peptide chains with T(1) ribonuclease gives a nucleoprotein particle that retains approx. 70% of the original labelled chains. Treatment of labelled nucleoprotein particles with 1mm-puromycin in the absence of transfer factors releases 20% of the labelled chains. Addition of GTP (0.48mumole) increases this release to 37%. 4. Treatment of nucleoprotein particles carrying (14)C-labelled peptide chains with either EDTA (50mm) or ammonium chloride (0.5m) brings about a small release of labelled material (approx. 15%). 5. Disruption of nucleoprotein particles carrying (14)C-labelled peptide chains with either sodium dodecyl sulphate or 2m-lithium chloride, followed by addition of transfer RNA as marker and chromatography on Sephadex G-200, show in both cases that considerable amounts of labelled peptide material move well ahead of the added transfer RNA marker. Further, if nucleoprotein particles carrying labelled peptide chains are treated with 0.3m-potassium hydroxide at 20 degrees for 24 hr., neutralized to pH7.6, and then chromatographed on Sephadex G-200, the labelled peptide material moves much closer to the added transfer RNA marker. These results suggest that a proportion of the nascent (14)C-labelled peptides on the nucleoprotein are attached to transfer RNA or large fragments of transfer RNA. 6. [(3)H]Polyuridylic acid binds to nucleoprotein particles in 1mm-magnesium chloride. The rate of binding is rapid when measured at 20 degrees .
| S-EPMC1184744 | biostudies-other
Project description:BORIS (CTCFL), a paralogue of the multifunctional and ubiquitously expressed transcription factor CTCF, is best known for its role in transcriptional regulation. In the nucleus, BORIS is particularly enriched in the nucleolus, a crucial compartment for ribosomal RNA and RNA metabolism. However, little is known about cytoplasmic BORIS, which represents the major pool of BORIS protein.We show, firstly, that BORIS has a putative nuclear export signal in the C-terminal domain. Furthermore, BORIS associates with mRNA in both neural stem cells and young neurons. The majority of the BORIS-associated transcripts are different in the two cell types. Finally, by using polysome profiling we show that BORIS is associated with actively translating ribosomes.We have demonstrated the RNA binding properties of cellular BORIS and its association with actively translating ribosomes. We suggest that BORIS is involved in gene expression at both the transcriptional and post-transcriptional levels.
| S-EPMC4219345 | biostudies-literature
Project description:This study will analyse the guide sequence which were used for making mutations in the Cas9-expressing cells. We used GeCKO v2 library which were released by Feng Zhang, 2014.
This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/
| EGAS00001001256 | EGA
Project description:Hepatocellular carcinoma (HCC) represents the fifth most common form of cancer worldwide and carries a high mortality rate due to lack of effective treatment. Males are eight times more likely to develop HCC that females, an effect largely driven by sex hormones, albeit through still poorly understood mechanisms. We previously identified TRIM28, a scaffold protein capable of recruiting a number of chromatin modifiers, as a crucial mediator of sexual dimorphism in the liver, with Trim28hep-/- mice displaying sex-specific transcriptional deregulation of a wide range of bile and steroid metabolism genes and development of liver adenomas in males. We now demonstrate that obesity and ageing precipitate alterations of TRIM28-dependent transcriptional dynamics, leading to a metabolic infection state responsible for highly penetrant male-restricted hepatic carcinogenesis. Molecular analyses implicate aberrant androgen receptor stimulation, biliary acid disturbances and altered responses to gut microbiota in the pathogenesis of Trim28hep-/--associated HCC. Correspondingly, androgen deprivation markedly attenuates the frequency and severity of tumors, and raising animals under axenic conditions completely abrogates their abnormal phenotype, even upon high-fat diet challenge. This work underpins how discrete polyphenic traits in epigenetically unstable conditions can contribute to a cancer-prone state, and more broadly provides new evidence linking hormonal imbalances, metabolic disturbances, gut microbiota and cancer.
2017-08-22 | GSE86389 | GEO