Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Study of Neratinib +Trastuzumab or Neratinib + Cetuximab in Patients With KRAS/NRAS/BRAF/PIK3CA Wild-Type Metastatic Colorectal Cancer by HER2 Status

ABSTRACT: This is a phase II trial to examine the efficacy of neratinib plus trastuzumab or neratinib plus cetuximab in patients with "quadruple wild-type" (all RAS/NRAS/BRAF/PIK3CA wild-type), metastatic colorectal cancer based on HER2 status (amplified, non-amplified [wild-type] or mutated). Patients must have confirmed quadruple wild-type (WT) genotype, via NSABP MPR-1 or from colonic biopsy or a metastatic biopsy taken prior to treatment, and known HER2 status.

DISEASE(S): Metastatic Colorectal Cancer,Colorectal Neoplasms

PROVIDER: 2267768 | ecrin-mdr-crc |

REPOSITORIES: ECRIN MDR

ACCESS DATA

Json Xml

Similar Datasets

Study of gene targets regulated by oncogenic PIK3CA and/or Her2

Project description:Mutant PIK3CA and Her2 genes are oncogenic and their co-existence in breast cancer has been well identified. However, the gene targets and cell signalling pathway regulated by mutant PIK3CA, Her2 and both of PIK3CA and Her2 have not been well studied. We established stable cell models through transfecting mutant PIK3CA, Her2 and both mutant PIK3CA and Her2 into MCF10A cells and performed Affymetrix microarray to identify downstream target genes controlled by either mutant PIK3CA, Her2 or both PIK3CA and Her2.

2017-06-01 | GSE99512 | GEO

Development of gene expression signatures for MCF10A cell lines carrying HER2 and WT or H1047R PIK3CA oncogenes.

Project description:We wanted to know how introduction of H1047R oncogenic mutation of PIK3CA (p110a subunit of PI3K) in HER2-overexpressing MCF10A human non-transformed mammary epitheial cell lines introduces change in gene expression levels. Our control was HER2-overexpressing MCF10A cell line with wild-type (WT) PIK3CA. Mutated oncogene-induced gene expression signature was measured and compared with that induced by the WT oncogene from cell lines harvested at 70-80% confluency.

2021-03-16 | GSE117389 | GEO

Prospective biomarker analysis of the randomized CHER-LOB study evaluating the dual anti-HER2 treatment with chemotherapy plus trastuzumab and lapatinib as neoadjuvant therapy for HER2-positive breast cancer [copy number]

Project description:The CHER-LOB randomized phase II study showed that the combination of lapatinib and trastuzumab plus chemotherapy increases the pathologic complete remission (pCR) rate as compared to chemotherapy plus either trastuzumab or lapatinib. An extensive biomarker programme was prospectively planned to identify potential predictors of sensitivity to different treatments and evaluate treatment effect on tumor biomarkers. A mutation in PIK3CA exon 20 or 9 was documented in 20% of the cases. Overall, the pCR rates were similar in PIK3CA wild type and PIK3CA mutated patients (33.3% vs 22.7%; p=0.323). However, for patients receiving trastuzumab plus lapatinib, the probability of pCR was higher in PIK3CA wild type tumors (48.4% vs 12.5%; p=0.06). Ki67, pAKT and apoptosis measured on the residual disease were significantly reduced from baseline. The degree of Ki67 inhibition was significantly higher in patients receiving the dual anti-HER2 blockade. In conclusion, PIK3CA mutations seem to identify patients less likely to benefit from dual anti-HER2 inhibition. p95-HER2 and markers of PI3K pathway deregulation are not confirmed as markers of different sensitivity to trastuzumab or lapatinib.

2015-10-06 | GSE66398 | GEO

2015-10-06 | GSE66305 | GEO

Proteomic Analysis of wild-type and PIK3CA mutant cell lines

Project description:Wild-type and PIK3CA mutant MCF10A cell lines were analyzed using shotgun proteomics to identify proteins that were altered by either 545K or H1047R PIK3CA mutations. Cell lines were digested and fractionated using isoelectric focusing and peptides were analyzed using LC-MS/MS analysis.

2015-03-05 | MSV000079060 | MassIVE

Expression data from HER2 L755S, PIK3CA E545K, and co-cultured cells in the MCF-10A background

Project description:When co-cultured, HER2 L755S mutant cells are induced to proliferate when coming into close contact with PIK3CA E545K mutant cells We used a microarray to compare transciptome-wide expression levels between HER2 L755S cells, PIK3CA E545K cells, and co-cultures containing both cell types.

2021-03-18 | GSE165065 | GEO

Heterozygous and homozygous knock-in of PIK3CA-H1047R into human iPSCs

Project description:We used CRISPR/Cas9 to knock in the cancer "hotspot" mutation PIK3CA-H1047R into one or both alleles of a wild-type induced pluripotent stem cell (iPSC) line (WTC11; Coriell # GM25256; P37-P38). Three clones from each genotype (wild-type, heterozygous, homozygous) were subjected to single-end mRNA sequencing (mean read depth per sample: 20 million) to determine whether PIK3CA-H1047R exerts allele dose-dependent transcriptional effects. Multidimensional scaling demonstrated distinct transcriptomic signatures of wild-type, heterozygous and homozygous cells. The transcriptome of heterozygous cells was nearly identical to wild-type controls, with only 131 differentially-expressed transcripts (FDR = 0.05). In contrast, homozygosity for PIK3CA-H1047R led to differential expression of 1,914 genes. This indicates widespread transcriptional remodeling with a sharp allele dose-dependency, suggestive of a threshold effect.

2019-02-15 | GSE126562 | GEO

High-depth RNA sequencing of isogenic wild-type, PIK3CA-WT/H1047R and PIK3CA-H1047R/H1047R human iPSCs

Project description:We used CRISPR/Cas9 to knock in the cancer "hotspot" mutation PIK3CA-H1047R into one or both alleles of a wild-type induced pluripotent stem cell (iPSC) line (WTC11; Coriell # GM25256; P37-P38). Four cultures from each genotype (3 wild-type clones, 3 heterozygous clones, 2 homozygous clones) were subjected to paired-end mRNA sequencing (mean read length = 150 bp). The aim of this experiment was to confirm and expand upon previous transcriptomic results suggesting a near-binary transcriptional effect in homozygous versus heterozygous PIK3CA-H1047R iPSCs (publication doi: 10.1073/pnas.1821093116). According to the high-depth transcriptomic dataset, PIK3CA-H1047R/H1047R iPSCs exhibited altered expression of 5644 genes, whereas heterozygous hPSCs showed 492 differentially-expressed genes, supporting a nearly deterministic phenotypic effect of homozygosity for PIK3CA-H1047R. The differential gene expression analyses were performed based on the limma/voom/eBayes framework (doi: 10.1093/nar/gkv007), using customised scripts with FDR < 0.05 and absolute log2(fold-change) cut-off >= 1.3.

2019-10-01 | GSE134076 | GEO

Transcriptome analysis of tumors from genetically engineered mouse models carrying Cbfb and/or Pik3ca mutations

Project description:Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.

2024-10-22 | GSE206598 | GEO

High-depth RNA sequencing of isogenic wild-type, PIK3CA-WT/H1047R and PIK3CA-H1047R/H1047R human iPSCs

Project description:High-depth RNA sequencing of isogenic wild-type, PIK3CA-WT/H1047R and PIK3CA-H1047R/H1047R human iPSCs

| PRJNA553693 | ENA