Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A7bcbc51-217a-491f-808b-617da8eeca65 - samples

ABSTRACT: Fecal samples Illumina MiSeq 16S rRNA sequencing, V4 hypervariable region

PROVIDER: EGAD00001004106 | EGA |

REPOSITORIES: EGA

ACCESS DATA

Json Xml

Similar Datasets

ena-DATASET-KULVIB-19-10-2018-12:35:21:241-524 - samples

Project description:16S rRNA gene sequencing with Illumina MiSeq (V4 hypervariable region)

| EGAD00001004406 | EGA

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Gut microbiota analysis of colitic SD rats

Project description:Fecal samples collected on day 5 from randomly selected colitic SD rats were analyzed for gut microbiota by sequencing the V4 region of the 16S rRNA gene. The orally administered Dex-P-laden NPA2 coacervate (Dex-P/NPA2) significantly restores the diversity of gut microbiota compared with colitic SD rats in the Dex-P/PBS group and the untreated colitic rats (Control).

2021-11-06 | GSE167138 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Microbiota and Complications in Kidney Transplant Recipients

Project description:In this study, we investigated the role of the gut microbiota on the development of complications in kidney transplant recipients. We collected serial fecal specimens from 168 kidney transplant recipients within the first 3 months after transplantation. We performed 16S rRNA gene sequencing of the V4-V5 hypervariable region and examined whether the relative gut abundance of pathogenic bacteria was associated with future development of complications like bacteriuria and urinary tract infections. In a subset of samples, we performed metagenomic sequencing of stool and urine supernatant specimens to determine strain level analysis.

| phs001879 | dbGaP

Multiomic Approach to Analyze Infant Gut Microbiota: Experimental and Analytical Method Optimization

Project description:BACKGROUND: The human intestinal microbiome plays a central role in overall health status, especially in early life stages. 16S rRNA amplicon sequencing is used to profile its taxonomic composition; however, multiomic approaches have been proposed as the most accurate methods for study of the complexity of the gut microbiota. In this study, we propose an optimized method for bacterial diversity analysis that we validated and complemented with metabolomics by analyzing fecal samples.METHODS: Forty-eight different analytical combinations regarding (1) 16S rRNA variable region sequencing, (2) a feature selection approach, and (3) taxonomy assignment methods were tested. A total of 18 infant fecal samples grouped depending on the type of feeding were analyzed by the proposed 16S rRNA workflow and by metabolomic analysis.RESULTS: The results showed that the sole use of V4 region sequencing with ASV identification and VSEARCH for taxonomy assignment produced the most accurate results. The application of this workflow showed clear differences between fecal samples according to the type of feeding, which correlated with changes in the fecal metabolic profile.CONCLUSION: A multiomic approach using real fecal samples from 18 infants with different types of feeding demonstrated the effectiveness of the proposed 16S rRNA-amplicon sequencing workflow.

2021-08-18 | MTBLS2942 | MetaboLights

16S rDNA sequencing of BALB/c and C57BL/7 mouse gut microbiomes

Project description:Age-dependent changes of the gut-associated microbiome have been linked to increased frailty and systemic inflammation. This study found that age-associated changes of the gut microbiome of BALB/c and C57BL/6 mice could be reverted by co-housing of aged (22 months old) and adult (3 months old) mice for 30-40 days or faecal microbiota transplantation (FMT) from adult into aged mice. This was demonstrated using high-throughput sequencing of the V3-V4 hypervariable region of bacterial 16S rRNA gene isolated from faecal pellets collected from 3-4 months old adult and 22-23 months old aged mice before and after co-housing or FMT.

2019-05-08 | E-MTAB-7750 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data