Dataset Information

CRISPR/Cas9-mediated genome editing of Schistosoma mansoni acetylcholinesterase

ABSTRACT: Here we report successful gene knock-in (KI) in the eggs of Schistosoma mansoni by combining CRISPR/Cas9 with single-stranded oligodeoxynucleotides (ssODNs). We targeted the acetylcholinesterase (AChE) gene of S. mansoni using two synthetic guide RNAs (gRNAs), X5 and X7, respectively. Liver eggs of S. mansoni were exposed to CRISPR-vector containing X5 or X7 by electroporation. Simultaneously, eggs were transfected with a ssODN donor encoding a stop codon in all six frames. Next generation sequencing analysis revealed that CRISPR/Cas9-mediated editing in S. mansoni eggs resulted in Homology-Directed Repair (HDR) when template DNA ssODN provided. Furthermore, soluble egg antigen (SEA) from AChE-modified eggs exhibited markedly reduced AChE activity compared with controls, indicative that programmed Cas9 cleavage mutated the AChE gene. Following injection of modified schistosome eggs into the tail veins of mice, a significant decrease in granuloma size in the lungs of these animals. Notably, an enhanced Th2 response induced by eggs in lung, and splenocytes small intestine-draining mesenteric lymph node cells was also generated in mice injected with X5-KI eggs in different methods. These findings further demonstrate the power and utility of CRISPR/Cas9-based genome editing for undertaking functional genomics studies in schistosomes.

PROVIDER: EGAS00001004455 | EGA |

REPOSITORIES: EGA

ACCESS DATA

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

CRISPR/Cas9-mediated genome editing of Schistosoma mansoni acetylcholinesterase

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets