Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

ABSTRACT: High-throughput RNA sequencing technologies provide an unprecedented opportunity to explore the individual transcriptome. Unmapped reads are a large and often overlooked output of standard RNA-seq analyses. Here, we present Read Origin Protocol (ROP), a tool for discovering the source of all reads originating from complex RNA molecules. We apply ROP to samples across 2630 individuals from 54 diverse human tissues. Our approach can account for 99.9% of 1 trillion reads of various read length. Additionally, we use ROP to investigate the functional mechanisms underlying connections between the immune system, microbiome, and disease. ROP is freely available at http://smangul1.github.io/rop/.

ORGANISM(S): Homo sapiens

PROVIDER: GSE109313 | GEO | 2018/01/23

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

Project description:High-throughput RNA sequencing technologies provide an unprecedented opportunity to explore the individual transcriptome. Unmapped reads are a large and often overlooked output of standard RNA-seq analyses. Here, we present Read Origin Protocol (ROP), a tool for discovering the source of all reads originating from complex RNA molecules. We apply ROP to samples across 2630 individuals from 54 diverse human tissues. Our approach can account for 99.9% of 1 trillion reads of various read length. Additionally, we use ROP to investigate the functional mechanisms underlying connections between the immune system, microbiome, and disease. ROP is freely available at http://smangul1.github.io/rop/.

2018-01-23 | GSE109484 | GEO

ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

Project description:ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

| PRJNA430406 | ENA

ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

Project description:ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

| PRJNA431176 | ENA

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

Merging short and stranded long reads improves transcript assembly

Project description:New tools for improved long-read transcript assembly and coalescence with its short-read counterpart are required. Using our short- and long-read measurements from different cell lines with spiked-in standards, we systematically compared key parameters and biases in the read alignment and assembly of transcripts. We report a cDNA synthesis artifact in long-read datasets that impacts the identity and quantitation of assembled transcripts. We developed a computational pipeline to strand long-read cDNA libraries that markedly improves assembly of transcripts from long-reads. Incorporating stranded long-reads in a new hybrid assembly approach, we demonstrate its efficacy for improved characterization of challenging lncRNA transcripts. Our workflow can be applied to a wide range of transcriptomics datasets for superior demarcation of transcript ends and refined isoform structure, which can enable better differential gene expression analyses and molecular manipulations of transcripts.

2023-10-14 | GSE215357 | GEO

Merging short and stranded long reads improves transcript assembly

2023-10-14 | GSE215355 | GEO

CPCG.RNASeq-ProstateCancer-RNA-Seq-unmapped-reads - samples

Project description:Prostate Cancer - RNA-Seq unmapped reads

| EGAD00001003756 | EGA

RNA-seq of H1N1 infected monocyte-derived dendritic cells (MoDC), stimulated with single-stranded oligonucleotides (ssON) and/or Poly I:C.

Project description:Evaluation of modulation of the innate immune response during H1N1 infection. The modulatory effect of Single-stranded oligonucleotides (ssON) on monocyte-derived dendritic cells (MoDCs) are evaluated. RNAseq data are used to study the effect on the transcriptome of MoDCs, during infection with simultaneous addition of ssON. Further mechanistic information are added via RNAseq data on poly I:C stimulated MoDCs (Toll-Like Receptor 3 agonist). Control samples are included to perform differential expression analysis. Provided are the fastq files, obtained in the following manner: The RNA sequencing was performed with the TruSeq RiboZero kit from Illumina, 25 M reads per sample and 2x125bp. Read quality were assessed using FastQC (Version 0.11.5) Trim Galore (Version 0.3.6) was used for adapter removal and quality trimming with a quality threshold of 20 on the Phred scale. Count files was created out of the trimmed fastq by mapping high-quality reads to Homo sapiens UCSC hg38 (GRCh38.77) reference genome using STAR aligner (version 2.5) with default values and the parameter out Reads Unmapped set to Fastx in order to extract the unmapped reads. After STAR alignment, the count data for the aligned reads were generated with HTSeq-count (version 0.6.1). The-m parameter was set to union.

2019-05-03 | E-MTAB-7803 | biostudies-arrayexpress

Morus alba Raw protein sequence reads

Project description:Morus alba L. Raw protein sequence reads and sequence

2024-02-08 | PXD049451 |

3âREADS+, a sensitive and accurate method for 3â end sequencing of polyadenylated RNA

Project description:Sequencing of the 3â end of poly(A)+ RNA identifies cleavage and polyadenylation sites (pAs) and measures transcript expression. We previously developed a method, 3â region extraction and deep sequencing (3âREADS), to address mispriming issues that often plague 3â end sequencing. Here we report a new version, named 3âREADS+, which has vastly improved accuracy and sensitivity. Using a special locked nucleic acid oligo to capture poly(A)+ RNA and to remove bulk of the poly(A) tail, 3âREADS+ generates RNA fragments with an optimal number of terminal As that balance data quality and detection of genuine pAs. With improved RNA ligation steps for efficiency, the method shows much higher sensitivity (over two orders of magnitude) compared to the previous version. Using 3âREADS+, we have uncovered a sizable fraction of previously overlooked pAs located next to or within a stretch of adenylate residues in human genes, and more accurately assessed the frequency of alternative cleavage and polyadenylation (APA) in HeLa cells (~50%). 3âREADS+ will be a useful tool to accurately study APA and to analyze gene expression by 3â end counting, especially when the amount of input total RNA is limited. Nine 3'READS+ libraries were made with different amounts (100 ng, 200 ng, 400 ng, 1000 ng, 5000 ng, 15000 ng) of input Hela RNA.

2016-08-14 | E-GEOD-84170 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data