Global gene expression profile of primary cultured keratinocytes with or without stimulation
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE109833 | GEO | 2018/04/03
REPOSITORIES: GEO
Similar Datasets
Project description:Colon tissues from 6-8 week BALB/c mice and STAT6-/- mice having 3% DSS for 3 days were obtained. Total RNAs were isolated with Trizol (invitrogen) and the RNA-seq library was prepared by the Beijing Genomics Institute. Sequence reads were obtained using BGIseq500 and successfully mapped to mouse genome. Reads counts were normalized based on FPKM, fold changes were calculated for all possible comparisons.
2018-04-24 | GSE113541 | GEO
Project description:Susceptible (CO39 and NPB) and resistant (Pi_gm) rice cultivars were spray inoculated with P. oryzae spore and incubated for 12-hours. Total RNA was extracted from the inoculated rice seedlings (T_Co39, T_NPB, and T_gm) along with their non-inoculated control group C_Co39, C_NPB, and C_gm. The extraction of total RNA from inoculated and non-inoculated control samples was carried-out with RNAprep pure Plant Kit (Tiangen, Beijing) by following processes recommended by the manufacturer. To observe the level of RNA degradation and contamination, the extracted RNA was run on 1% agarose gels. RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA concentration was measured with RNA Assay Kit in Qubit 2.0 Fluorometer (Life Technologies, CA, USA). The cDNA library was sequenced on the Illumina sequencing platform (Illumina HiSeq™ 2000) with 150 bp pair-end reads length and 300 bp insert size by Gene Denovo Co. (Guangzhou, China). Novogene in-house Perl script was used to select clean reads by removing adaptor sequences, low quality sequences (reads with more than 50% of bases quality lower than 20) and reads with more than 5% N bases.
2019-02-23 | GSE126961 | GEO
Project description:We sought to explore the underlying mechanisms by which MCUR1 promotes erythropoiesis. Total RNAs were extracted from cultured human CD34+ HPCs stably expressing sh-MCUR1 or sh-Ctrl under hypoxia (1% O2) following 2 days of EPO stimulation, using TRIZOL Reagent (Invitrogen, CA, USA). RNA sequencing (RNA-seq) was performed using Illumina NovaSeq6000 at Berry Genomics Co. Ltd. (Beijing, China), and a mean of 40 million paired-end reads per sample was obtained.
2021-03-30 | GSE171094 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:Purpose: Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis Methods: RNA from 14-day-old seedlings of wild-type and pkl was isolated using the RNAprep Pure Plant Kit as described above. RNAs from three biological replicates was sequenced separately at Novogene, using Illumina Hiseq X-Ten (Sequencing method: Hiseq-PE150). Results: Reads were mapped to the TAIR10 Arabidopsis genome using TopHat (Galaxy V2.1.1 in usegalaxy.org) with default settings, except that a minimum intron length of 20 bp and a maximum intron length of 5,000 bp were required (Paired-end). Then, mapped reads were assembled according to TAIR10 version of genome annotation using cufflinks (version 2.1.1) with default settings. To analyze differential expression, the assembled transcripts from three independent biological replicates in Col and other mutants were included and compared using Cuffdiff (version 2.1.1) with default settings. 14-day-old seedling of WT and pkl were performed RNA-seq to analyzed their differential expression genes in Arabidopsis.
2022-12-12 | GSE186152 | GEO
Project description:RNAseq analysis was performed to evaluate gene expression differences between strains JNB5-1 and ZK66. S. marcescens JNB5-1 and ZK66 cells were grown in LB medium for 12 h before harvesting. The collected cells were then treated with RNAprep pure Kit (TIANGEN) to extract total bacterial RNA and delivered to GENEWIZ in dry ice for transcriptome resequencing analysis. For annotation, the genome of S. marcescens WW4 (NC_020211.1) was used as reference. A total of 24048918 reads matched to the referenced genome in the sample of JNB5-1, and 24569696 reads in the sample of ZK66. The differentially expressed genes (DEGs) were determined between strains JNB5-1 and ZK66 with the standards of false discovery rate (FDR) ≤ 0.05, fold change |log2Ratio|≥1. Transcriptome data showed that expression of 641 genes were upregulated while 784 genes were down regulated by at least 2-fold when comparing the metR mutant strain ZK66 to its parent strain JNB5-1. Based on the annotation of KEGG_B_class, the up-regulated and down-regulated genes were classified into 30 and 27 major cellular processes, respectively. The transcriptome data indicated that MetR may regulate a variety of cellular processes in S. marcescens, including prodigiosin synthesis, and cell motility.
2019-06-20 | GSE133030 | GEO
Project description:Purpose: Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis Methods: RNA from 14-day-old seedlings of wild-type, brip1, brip2, brm-3, brm-1, brip1 brip2, brip1 brip2 brm-3 and brip1 brip2 brm-1 was isolated using the RNAprep Pure Plant Kit as described above. RNAs from three biological replicates was sequenced separately at Novogene, using Illumina Hiseq X-Ten (Sequencing method: Hiseq-PE150). Results: Reads were mapped to the TAIR10 Arabidopsis genome using TopHat (Galaxy V2.1.1 in usegalaxy.org) with default settings, except that a minimum intron length of 20 bp and a maximum intron length of 4,000 bp were required (Paired-end). Then, mapped reads were assembled according to TAIR10 version of genome annotation using cufflinks (version 2.1.1) with default settings. To analyze differential expression, the assembled transcripts from three independent biological replicates in Col and other mutants were included and compared using Cuffdiff (version 2.1.1) with default settings. Conclusions: Our study represents the first detailed analysis of brip1, brip2, brip1 brip2 transcriptomes, with biologic replicates, generated by RNA-seq technology.
2020-06-21 | GSE142622 | GEO
Project description:Purpose: Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis Methods: RNA from 14-day-old seedlings of wild-type and pkl was isolated using the RNAprep Pure Plant Kit as described above. RNAs from three biological replicates was sequenced separately at Novogene, using Illumina Hiseq X-Ten (Sequencing method: Hiseq-PE150). Results: Reads were mapped to the TAIR10 Arabidopsis genome using TopHat (Galaxy V2.1.1 in usegalaxy.org) with default settings, except that a minimum intron length of 20 bp and a maximum intron length of 5,000 bp were required (Paired-end). Then, mapped reads were assembled according to TAIR10 version of genome annotation using cufflinks (version 2.1.1) with default settings. To analyze differential expression, the assembled transcripts from three independent biological replicates in Col and other mutants were included and compared using Cuffdiff (version 2.1.1) with default settings. 14-day-old seedling of WT and val1 val2 pkl were performed RNA-seq to analyzed their differential expression genes in Arabidopsis.
2022-12-12 | GSE186156 | GEO
Project description:RNAseq analysis was performed to evaluate gene expression differences between strains JNB5-1 and SK68. S. marcescens JNB5-1 and SK68 cells were grown in LB medium for 4 h before harvesting. The collected cells were then treated with RNAprep pure Kit (TIANGEN) to extract total bacterial RNA and delivered to GENEWIZ in dry ice for transcriptome resequencing analysis. For annotation, the genome of S. marcescens WW4 (NC_020211.1) was used as reference. A total of 32420858 reads matched to the referenced genome in the sample of JNB5-1, and 32993470 reads in the sample of SK68. The significantly differentially expressed genes (DEGs) were determined between strains JNB5-1 and SK68 with the standards of p-value≤ 0.05, fold change |log2Ratio|≥1. Transcriptome data showed that expression of 210 genes were significantly up-regulated while 106 genes were significantly down-regulated by at least 2-fold when comparing the rcsB mutant strain SK68 to its parent strain JNB5-1. Based on the annotation of KEGG_B_class, the up-regulated and down-regulated genes were classified into 18 and 17 major cellular processes, respectively. The transcriptome data indicated that RcsB may regulates a variety of cellular processes in S. marcescens, including prodigiosin synthesis, and cell motility.
2020-04-28 | GSE149400 | GEO