Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Nucleotide resolution of RNA polymerase II transcription in human cytomegalovirus

ABSTRACT: We performed paired-end PRO-Seq and/or PRO-Cap on human foreskin fibroblasts (HFF) infected with human cytomegalovirus (HCMV) for 4 h (strain TB40/E) or 96 h (strain Towne varS). Each sample has matched uninfected controls. Towne experiments were also performed with adapters containing 4 nt of random sequence flanking both sides (8 total bases of randomness) to enable deduplication. Reads were first mapped to the human genome (hg38) (files available on GEO). Unmapped reads were then mapped to HCMV (Genbank FJ616285.1) (track hub available at https://github.com/P-TEFb/trackHub_HCMV).

ORGANISM(S): Homo sapiens

PROVIDER: GSE113394 | GEO | 2019/01/16

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Differences in RNA polymerase II complexes and their interactions with surrounding chromatin on human and cytomegalovirus genomes [Pro-seq]

Project description:To characterize transcription throughout the HCMV infection, paired-end PRO-Seq was performed on human foreskin fibroblasts (HFF) infected with human cytomegalovirus (HCMV) for 4 h, 12 h, 24 h, 48 h, and 72 h using the TB40/e strain. Cells were treated with 1µM flavopiridol 1 hour prior to isolation. Additionally, PRO-Cap was performed on untreated HFFs after 72 h of infection. Each experiment was performed with adapters containing 8 nt of random sequence flanking both ends (16 total bases of randomness) to enable deduplication.

2022-02-17 | GSE185762 | GEO

Identification of polyA sites in Drosophila melanogaster

Project description:The 3' ends of most Drosophila melanogaster genes are poorly annotated or are determined by only a single EST or cDNA clone. To enhance the annotation of poly(A) site use in Drosophila, we performed deep sequencing on RNA isolated from 29 dissected tissues using an approach designed to enrich for poly(A) spanning reads. From these experiments, we identified 1.4 million poly(A) spanning reads leading to the identification of many new poly(A) sites and the identification of many tissue-specific poly(A) sites. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf RNA from 29 dissected Drosophila melanogaster tissues (in duplicate) were used to prepare polyA enriched RNA-Seq libraries. Briefly, total RNA was poly(A) selected, fragmented, and ligated to 5' and 3' RNA linkers. These libraries were amplified using Illumina paired-end primers, and subsequently reamplified using a 3' primer complementary to the 3' adapter but containing 6 Ts at the 3' end. The libraries were also multiplexed and up to 12 samples mixed per lane and sequenced on an Illumina GAIIx using paired-end 76 bp reads, or an illumina HiSeq 2000 using paired-end 100 bp reads. All reads were mapped to the Drosophila melanogaster genome to identify unmapped reads. Unmapped reads containing at least 10 A residues at the 3' end were identified, the terminal A residues trimmed, realigned to the genome to identify uniquely mapped reads. Such reads were identified as polyA spanning reads

2011-11-23 | E-GEOD-33905 | biostudies-arrayexpress

Next generation sequencing reveals no change in mtDNA deletions upon the loss of mitochondrial fusion in mouse hearts

Project description:Aim: To determine whether mtDNA deletions arise upon the loss of mitochondria fusion in heart tissue Method: DNA was isolated heart mitochondria from control and heart-specific double mitofusin1-2 (dMfn) KO animals and used to generate libraries for sequencing to detect mtDNA deletions. Total genomic DNA from the Deletor mouse was provided by Anu Suomalainen-Wartiovaara and used as a positive control for the detection of mtDNA rearrangements. A standard Illumina TrueSeq paired-end library was prepared with ~500 base pair fragment inserts. Paired-end 100 base pair sequencing was conducted using an Illumina HiSeq 2500. The reads were mapped to the genomic sequence without the mitochondria using bowtie (VN: 2.1.0) to remove nuclear-genomic sequences. The unmapped reads were then mapped to the mitochondrial sequence (GenBank JF286601.1) using bwa (n=0.04, VN: 0.6.2-r126) with unmapped reads undergoing an additional mapping round after trimming fastx_trimmer, VN: 0.0.13.2) to ensure higher mapping results. Using samtools (VN: 1.0: samtools –f1 –F14) reads, where the two paired sequences were observed to be greater than 600 base pair apart were identified as those containing deletion breakpoints. These reads were extracted for additional analysis. Results: Control and dMfn KO samples showed similar frequencys of breakpoints, while the positive control (Deletor mouse) showed a high frequecny of large breakpoints.

2018-12-28 | GSE124420 | GEO

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

Project description:High-throughput RNA sequencing technologies provide an unprecedented opportunity to explore the individual transcriptome. Unmapped reads are a large and often overlooked output of standard RNA-seq analyses. Here, we present Read Origin Protocol (ROP), a tool for discovering the source of all reads originating from complex RNA molecules. We apply ROP to samples across 2630 individuals from 54 diverse human tissues. Our approach can account for 99.9% of 1 trillion reads of various read length. Additionally, we use ROP to investigate the functional mechanisms underlying connections between the immune system, microbiome, and disease. ROP is freely available at http://smangul1.github.io/rop/.

2018-01-23 | GSE109484 | GEO

ROP: Dumpster Diving in RNA-sequencing to find the source of 1 trillion reads across diverse adult human tissues

2018-01-23 | GSE109313 | GEO

PanCurX-RNA-Seq-reads - samples

Project description:Integration of Genomic and Transcriptional Features in Pancreatic Cancer Reveals Increased Cell Cycle Progression in Metastases - RNA-Seq mapped and unmapped reads

| EGAD00001004548 | EGA

Human cytomegalovirus protein pUL36: a dual cell death pathway inhibitor

Project description:Human cytomegalovirus (HCMV) is an important human pathogen and a paradigm of intrinsic, innate and adaptive viral immune evasion. Here, we employ multiplexed tandem mass tag-based proteomics to characterise host proteins targeted for degradation late during HCMV infection. This approach revealed that mixed lineage kinase domain-like protein (MLKL), a key terminal mediator of cellular necroptosis, was rapidly and persistently degraded by the minimally passaged HCMV strain Merlin but not the extensively passaged strain AD169. The strain Merlin viral inhibitor of apoptosis pUL36 was necessary and sufficient both to degrade MLKL and to inhibit necroptosis. Furthermore, mutation of pUL36 Cys131 abrogated MLKL degradation and restored necroptosis. As the same residue is also required for pUL36-mediated inhibition of apoptosis by preventing proteolytic activation of pro-caspase 8, we define pUL36 as a multifunctional inhibitor of both apoptotic and necroptotic cell death.

2020-07-10 | PXD017279 | Pride

The prevalence of human cytomegalovirus in colorectal cancer and viral gene expression profiles

Project description:Five HCMV (+) CRC tissues detected by PCR were selected for RNA-seq. GEPs were pre-processed by Cutadapter and FastQC to remove jointed reads and low-quality reads. Tophat (v.2.0.0) was used to compare the sequences with Homo sapiens and HCMV genomes. The GEPs of HCMV was determined by Integrated Genomics Viewer (IGV) and Partek® Genomics Suite™ (version 6.5 beta, Partek Inc., St. Louis, MO, USA).

2021-04-30 | GSE173609 | GEO

Selective degradation of the miR-17 family members of the miR-17-92 cluster by human Cytomegalovirus

Project description:miRNA microarrays were used to investigate host miRNA expression profiles during HCMV clinical strain infection. Human foreskin fibroblasts (HFFs) were infected with the HCMV clinical strain Toledo. To mimic the attenuated strain, we used ToledoΔ15kb, which lacks the 15-kb genomic segment in the UL/b’ region.

2013-05-09 | GSE43761 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data