ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
PROVIDER: GSE12037 | GEO | 2008/08/16
SECONDARY ACCESSION(S): PRJNA113357
REPOSITORIES: GEO
Similar Datasets
Project description:The goal of this study was to identify small RNA-ARGONAUTE interactions in Arabidopsis. Co-immunoprecipitation assays followed by high-throughput sequencing were done to identify small RNA associated with HA-AGO2 and HA-AGO7. Experiment Overall Design: Sequencing-by-synthesis technology was used to sequence small RNA from input and co-immunoprecipitation fractions from cell lysates of inflorescence tissue from Arabidopsis plants transformed with HA epitope-tagged AGO2 or AGO7 constructs. Meaningful intepretation requires comparison between the input and co-immunoprecipitation datasets. Experiment Overall Design: Note: Raw data files requested, however, the submitter declined to provide them.
2009-08-30 | E-GEOD-12037 | biostudies-arrayexpress
Project description:Drosophila Argonaute-1 and Argonaute-2 differ in function and small RNA content. AGO2 binds to siRNAs, whereas AGO1 is almost exclusively occupied by microRNAs. microRNA duplexes are intrinsically asymmetric, with one strand, the miR strand, preferentially entering AGO1 to recognize and regulate the expression of target mRNAs. The other strand, miR*, has been viewed as a by-product of microRNA biogenesis. Here, we show that miR*s are often loaded as functional species into AGO2. This indicates that each microRNA precursor can potentially produce two mature small RNA strands that are differentially sorted within the RNAi pathway. miR* biogenesis depends upon the canonical microRNA pathway, but loading into AGO2 is mediated by factors traditionally dedicated to siRNAs. By inferring and validating hierarchical rules that predict differential AGO loading, we find that intrinsic determinants, including structural and thermodynamic properties of the processed duplex, regulate the fate of each RNA strand within the RNAi pathway.
2009-11-15 | GSE17734 | GEO
Project description:Drosophila Argonaute-1 and Argonaute-2 differ in function and small RNA content. AGO2 binds to siRNAs, whereas AGO1 is almost exclusively occupied by microRNAs. microRNA duplexes are intrinsically asymmetric, with one strand, the miR strand, preferentially entering AGO1 to recognize and regulate the expression of target mRNAs. The other strand, miR*, has been viewed as a by-product of microRNA biogenesis. Here, we show that miR*s are often loaded as functional species into AGO2. This indicates that each microRNA precursor can potentially produce two mature small RNA strands that are differentially sorted within the RNAi pathway. miR* biogenesis depends upon the canonical microRNA pathway, but loading into AGO2 is mediated by factors traditionally dedicated to siRNAs. By inferring and validating hierarchical rules that predict differential AGO loading, we find that intrinsic determinants, including structural and thermodynamic properties of the processed duplex, regulate the fate of each RNA strand within the RNAi pathway. These were independently processed and sequenced using the Illumina GAII platform. In total, five libraries were analyzed.
2009-11-15 | E-GEOD-17734 | biostudies-arrayexpress
Project description:Argonaute proteins lie at the heart of the RNA-Induced Silencing Complex (RISC), wherein they use small RNA guides to recognize targets. Some Argonaute proteins can directly cleave their targets, whereas others recruit co-factors to repress independently of “slicing.” Prior studies established the architecture of Argonaute proteins; however, we have not yet had a detailed picture of an Argonaute whose biochemical and biological functions were well established. Here we describe the crystal structure of human Argonaute-2 bound to miR-20a at 2.2 Å resolution. Overall architecture and domain organization is shared with its prokaryotic counterparts, though Ago2 is somewhat more open, with its PAZ domain further removed from the other domains. The miRNA is anchored at both ends by the Mid and PAZ domains but makes several kinks and turns along the binding groove. The RNA confers remarkable stability on the Argonaute protein, locking this otherwise flexible enzyme into a stable conformation. total small RNAs (19-29nt) and small RNAs associated with purified hArgonaute2 purified from SF9 cells. These were processed and sequenced on Illumina GA-II platform.
2012-05-12 | E-GEOD-37931 | biostudies-arrayexpress
Project description:Small non-coding RNAs function in concert with Argonaute (Ago) proteins to regulate gene expression at the level of transcription, mRNA stability or translation. Ago proteins bind small RNAs and form the core of silencing complexes. Here we report the analysis of small RNAs associated with human Ago1 and Ago2 revealed by immunoprecipitation and deep sequencing. Among the reads we find small RNAs originating from the small nucleolar RNA (snoRNA) ACA45. Moreover, processing of ACA45 requires Dicer activity but is independent of Drosha/DGCR8. Using bio-informatic prediction algorithms and luciferase reporter assays, we uncover the mediator subunit CDC2L6 as one potential mRNA target of ACA45 small RNAs suggesting a role for ACA45 processing products in post-transcriptional gene silencing. We further identify a number of human snoRNAs with microRNA (miRNA)- like processing signatures. We have therefore identified a novel class of small RNAs in human cells that originate from snoRNAs and can function like miRNAs.
2008-11-21 | GSE13370 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:MicroRNAs (miRNAs) perform critical functions in normal physiology and disease by associating with Argonaute proteins and downregulating partially complementary messenger RNAs (mRNAs). To identify new regulators of the miRNA pathway, we employed CRISPR-Cas9 genome-wide loss-of-function screening coupled with a fluorescent reporter of miRNA activity. Iterative rounds of screening revealed a novel mechanism whereby target engagement by Argonaute 2 (AGO2) triggers its hierarchical, multi-site phosphorylation by CSNK1A1 on a set of highly conserved residues (S824-S834), followed by rapid dephosphorylation by the ANKRD52-PPP6C phosphatase complex. Although genetic and biochemical studies demonstrated that AGO2 phosphorylation on these residues inhibits target mRNA binding, inactivation of this phosphorylation cycle globally impairs miRNA-mediated silencing. Analysis of the transcriptome-wide binding profile of non-phosphorylatable AGO2 revealed a dramatic expansion of the target repertoire bound at steady-state, effectively reducing the active pool of AGO2 on a per target basis. These findings support a model in which an AGO2 phosphorylation cycle stimulated by target engagement regulates miRNA:target interactions to maintain the global efficiency of miRNA-mediated silencing.
2017-01-17 | GSE89943 | GEO
Project description:MicroRNAs (miRNAs) perform critical functions in normal physiology and disease by associating with Argonaute proteins and downregulating partially complementary messenger RNAs (mRNAs). To identify new regulators of the miRNA pathway, we employed CRISPR-Cas9 genome-wide loss-of-function screening coupled with a fluorescent reporter of miRNA activity. Iterative rounds of screening revealed a novel mechanism whereby target engagement by Argonaute 2 (AGO2) triggers its hierarchical, multi-site phosphorylation by CSNK1A1 on a set of highly conserved residues (S824-S834), followed by rapid dephosphorylation by the ANKRD52-PPP6C phosphatase complex. Although genetic and biochemical studies demonstrated that AGO2 phosphorylation on these residues inhibits target mRNA binding, inactivation of this phosphorylation cycle globally impairs miRNA-mediated silencing. Analysis of the transcriptome-wide binding profile of non-phosphorylatable AGO2 revealed a dramatic expansion of the target repertoire bound at steady-state, effectively reducing the active pool of AGO2 on a per target basis. These findings support a model in which an AGO2 phosphorylation cycle stimulated by target engagement regulates miRNA:target interactions to maintain the global efficiency of miRNA-mediated silencing.
2017-01-17 | GSE89944 | GEO
Project description:Argonaute proteins lie at the heart of the RNA-Induced Silencing Complex (RISC), wherein they use small RNA guides to recognize targets. Some Argonaute proteins can directly cleave their targets, whereas others recruit co-factors to repress independently of “slicing.” Prior studies established the architecture of Argonaute proteins; however, we have not yet had a detailed picture of an Argonaute whose biochemical and biological functions were well established. Here we describe the crystal structure of human Argonaute-2 bound to miR-20a at 2.2 Å resolution. Overall architecture and domain organization is shared with its prokaryotic counterparts, though Ago2 is somewhat more open, with its PAZ domain further removed from the other domains. The miRNA is anchored at both ends by the Mid and PAZ domains but makes several kinks and turns along the binding groove. The RNA confers remarkable stability on the Argonaute protein, locking this otherwise flexible enzyme into a stable conformation.
2012-05-12 | GSE37931 | GEO
Project description:MicroRNAs (miRNAs) perform critical functions in normal physiology and disease by associating with Argonaute proteins and downregulating partially complementary messenger RNAs (mRNAs). To identify new regulators of the miRNA pathway, we employed CRISPR-Cas9 genome-wide loss-of-function screening coupled with a fluorescent reporter of miRNA activity. Iterative rounds of screening revealed a novel mechanism whereby target engagement by Argonaute 2 (AGO2) triggers its hierarchical, multi-site phosphorylation by CSNK1A1 on a set of highly conserved residues (S824-S834), followed by rapid dephosphorylation by the ANKRD52-PPP6C phosphatase complex. Although genetic and biochemical studies demonstrated that AGO2 phosphorylation on these residues inhibits target mRNA binding, inactivation of this phosphorylation cycle globally impairs miRNA-mediated silencing. Analysis of the transcriptome-wide binding profile of non-phosphorylatable AGO2 revealed a dramatic expansion of the target repertoire bound at steady-state, effectively reducing the active pool of AGO2 on a per target basis. These findings support a model in which an AGO2 phosphorylation cycle stimulated by target engagement regulates miRNA:target interactions to maintain the global efficiency of miRNA-mediated silencing.
2017-01-17 | GSE89940 | GEO