Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]

ABSTRACT: 4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected inside IGS. Our data indicate that mostly rDNA units exhibit close proximity with pericentromeric regions in different chromosomes. We also detected the contacts within a rDNA unit and between rDNA units.

ORGANISM(S): Homo sapiens

PROVIDER: GSE49193 | GEO | 2014/10/04

SECONDARY ACCESSION(S): PRJNA213263

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected inside IGS. Our data indicate that mostly rDNA units exhibit close proximity with pericentromeric regions in different chromosomes. We also detected the contacts within a rDNA unit and between rDNA units. Examination of rDNA genome-wide contacts in HEK 293T cells using 4C approach.

2014-10-04 | E-GEOD-49193 | biostudies-arrayexpress

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [K562]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in K562 cells.

2021-08-11 | GSE175910 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in hESM01 cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2021-08-11 | GSE175909 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-03 | GSE121413 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-05 | GSE121417 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

2022-12-01 | GSE121363 | GEO

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [DSBs]

Project description:Eukaryotic chromosomes are subjected to spontaneous fragmentation even under quick isolation of DNA in a solid phase by strong treatment with 0.1 M EDTA, 1% SDS and proteinase K (1 mg/ml). The long DNA fragments of excised chromosomal DNA were denoted as forum domains. Mostly forum domains are of 50-200 kb in length, although larger domains, up to 500 - 700 kb, are also observed. The domains are delimited by hot spots of double-strand breaks (DSBs). We performed a genome-wide mapping of DSBs in human HEK293T cells cultured cells using Illumina deep sequencing of the termini of forum domains. We found that in rDNA units the hot spots of DSBs are distributed non-randomly. Mostly they are located in IGS. Genome-wide mapping of DNA DSBs in HEK293T cells

2014-10-04 | E-GEOD-49302 | biostudies-arrayexpress

Genome-wide contacts of rDNA genes detected by 4C procedure (4C-rDNA) in Drosophila melanogaster S2 cells

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in D. melanogaster S2 cells.

2020-12-31 | GSE145321 | GEO

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [DSBs]

2014-10-04 | GSE49302 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome

| PRJNA497289 | ENA