Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [K562]

ABSTRACT: 4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in K562 cells.

ORGANISM(S): Homo sapiens

PROVIDER: GSE175910 | GEO | 2021/08/11

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in hESM01 cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2021-08-11 | GSE175909 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-03 | GSE121413 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-05 | GSE121417 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

2022-12-01 | GSE121363 | GEO

Genome-wide contacts of rDNA genes detected by 4C procedure (4C-rDNA) in Drosophila melanogaster S2 cells

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in D. melanogaster S2 cells.

2020-12-31 | GSE145321 | GEO

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected inside IGS. Our data indicate that mostly rDNA units exhibit close proximity with pericentromeric regions in different chromosomes. We also detected the contacts within a rDNA unit and between rDNA units. Examination of rDNA genome-wide contacts in HEK 293T cells using 4C approach.

2014-10-04 | E-GEOD-49193 | biostudies-arrayexpress

Genome-wide contacts of rDNA units detected by 4C procedure in human genome

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome

| PRJNA497289 | ENA

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]

2014-10-04 | GSE49193 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

| PRJNA497283 | ENA

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

| PRJNA497273 | ENA